ID: 923385189

View in Genome Browser
Species Human (GRCh38)
Location 1:233459347-233459369
Sequence AGTTTTGAGTCTCAATGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923385180_923385189 27 Left 923385180 1:233459297-233459319 CCAAAGTGCTGGGATTACAGGTG No data
Right 923385189 1:233459347-233459369 AGTTTTGAGTCTCAATGTCAGGG No data
923385179_923385189 28 Left 923385179 1:233459296-233459318 CCCAAAGTGCTGGGATTACAGGT No data
Right 923385189 1:233459347-233459369 AGTTTTGAGTCTCAATGTCAGGG No data
923385184_923385189 -8 Left 923385184 1:233459332-233459354 CCTGGCCAAGCCCGGAGTTTTGA No data
Right 923385189 1:233459347-233459369 AGTTTTGAGTCTCAATGTCAGGG No data
923385182_923385189 0 Left 923385182 1:233459324-233459346 CCACTGAGCCTGGCCAAGCCCGG No data
Right 923385189 1:233459347-233459369 AGTTTTGAGTCTCAATGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923385189 Original CRISPR AGTTTTGAGTCTCAATGTCA GGG Intergenic