ID: 923385190

View in Genome Browser
Species Human (GRCh38)
Location 1:233459356-233459378
Sequence TCTCAATGTCAGGGAGATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923385187_923385190 -10 Left 923385187 1:233459343-233459365 CCGGAGTTTTGAGTCTCAATGTC No data
Right 923385190 1:233459356-233459378 TCTCAATGTCAGGGAGATAGTGG No data
923385186_923385190 -9 Left 923385186 1:233459342-233459364 CCCGGAGTTTTGAGTCTCAATGT No data
Right 923385190 1:233459356-233459378 TCTCAATGTCAGGGAGATAGTGG No data
923385184_923385190 1 Left 923385184 1:233459332-233459354 CCTGGCCAAGCCCGGAGTTTTGA No data
Right 923385190 1:233459356-233459378 TCTCAATGTCAGGGAGATAGTGG No data
923385185_923385190 -4 Left 923385185 1:233459337-233459359 CCAAGCCCGGAGTTTTGAGTCTC No data
Right 923385190 1:233459356-233459378 TCTCAATGTCAGGGAGATAGTGG No data
923385182_923385190 9 Left 923385182 1:233459324-233459346 CCACTGAGCCTGGCCAAGCCCGG No data
Right 923385190 1:233459356-233459378 TCTCAATGTCAGGGAGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923385190 Original CRISPR TCTCAATGTCAGGGAGATAG TGG Intergenic