ID: 923385192

View in Genome Browser
Species Human (GRCh38)
Location 1:233459362-233459384
Sequence TGTCAGGGAGATAGTGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923385185_923385192 2 Left 923385185 1:233459337-233459359 CCAAGCCCGGAGTTTTGAGTCTC No data
Right 923385192 1:233459362-233459384 TGTCAGGGAGATAGTGGACAGGG No data
923385182_923385192 15 Left 923385182 1:233459324-233459346 CCACTGAGCCTGGCCAAGCCCGG No data
Right 923385192 1:233459362-233459384 TGTCAGGGAGATAGTGGACAGGG No data
923385186_923385192 -3 Left 923385186 1:233459342-233459364 CCCGGAGTTTTGAGTCTCAATGT No data
Right 923385192 1:233459362-233459384 TGTCAGGGAGATAGTGGACAGGG No data
923385187_923385192 -4 Left 923385187 1:233459343-233459365 CCGGAGTTTTGAGTCTCAATGTC No data
Right 923385192 1:233459362-233459384 TGTCAGGGAGATAGTGGACAGGG No data
923385184_923385192 7 Left 923385184 1:233459332-233459354 CCTGGCCAAGCCCGGAGTTTTGA No data
Right 923385192 1:233459362-233459384 TGTCAGGGAGATAGTGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923385192 Original CRISPR TGTCAGGGAGATAGTGGACA GGG Intergenic