ID: 923394476

View in Genome Browser
Species Human (GRCh38)
Location 1:233547408-233547430
Sequence CAGTGCAGGGAGAAGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923394476_923394484 26 Left 923394476 1:233547408-233547430 CCAGACACCTTCTCCCTGCACTG No data
Right 923394484 1:233547457-233547479 AATGATGCTTGATATCCTAGTGG No data
923394476_923394480 3 Left 923394476 1:233547408-233547430 CCAGACACCTTCTCCCTGCACTG No data
Right 923394480 1:233547434-233547456 TGAGTAATCTCATCTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923394476 Original CRISPR CAGTGCAGGGAGAAGGTGTC TGG (reversed) Intergenic
No off target data available for this crispr