ID: 923396424

View in Genome Browser
Species Human (GRCh38)
Location 1:233569295-233569317
Sequence ATGCTCCATACTTGCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923396420_923396424 4 Left 923396420 1:233569268-233569290 CCTATAAGTTTGCTTGCTTTCTG No data
Right 923396424 1:233569295-233569317 ATGCTCCATACTTGCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923396424 Original CRISPR ATGCTCCATACTTGCAAAGA GGG Intergenic
No off target data available for this crispr