ID: 923398321

View in Genome Browser
Species Human (GRCh38)
Location 1:233589817-233589839
Sequence CAGCTTTTCCAGGCCATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923398318_923398321 -4 Left 923398318 1:233589798-233589820 CCTCCTAAGGGACATAATACAGC No data
Right 923398321 1:233589817-233589839 CAGCTTTTCCAGGCCATCCATGG No data
923398317_923398321 -1 Left 923398317 1:233589795-233589817 CCACCTCCTAAGGGACATAATAC No data
Right 923398321 1:233589817-233589839 CAGCTTTTCCAGGCCATCCATGG No data
923398319_923398321 -7 Left 923398319 1:233589801-233589823 CCTAAGGGACATAATACAGCTTT No data
Right 923398321 1:233589817-233589839 CAGCTTTTCCAGGCCATCCATGG No data
923398314_923398321 20 Left 923398314 1:233589774-233589796 CCTTTCAGCTGCGGTTTGTCTCC No data
Right 923398321 1:233589817-233589839 CAGCTTTTCCAGGCCATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923398321 Original CRISPR CAGCTTTTCCAGGCCATCCA TGG Intergenic
No off target data available for this crispr