ID: 923401339

View in Genome Browser
Species Human (GRCh38)
Location 1:233618109-233618131
Sequence GGGCAGAGCTTCAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 535}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923401332_923401339 7 Left 923401332 1:233618079-233618101 CCCTTGTAATGAGGGTCTTCTTC 0: 1
1: 0
2: 2
3: 28
4: 151
Right 923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG 0: 1
1: 0
2: 3
3: 67
4: 535
923401333_923401339 6 Left 923401333 1:233618080-233618102 CCTTGTAATGAGGGTCTTCTTCA 0: 1
1: 0
2: 1
3: 7
4: 105
Right 923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG 0: 1
1: 0
2: 3
3: 67
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923401339 Original CRISPR GGGCAGAGCTTCAGGGAAGA AGG Intronic
900460452 1:2800123-2800145 GAGCAGAGCTTCAGGTGACAGGG + Intronic
900608115 1:3532790-3532812 GGGTAGAGCTGTGGGGAAGAAGG + Intronic
900800821 1:4735940-4735962 GAGCAGAGCTTAGAGGAAGAGGG + Intronic
901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG + Intergenic
902407375 1:16192033-16192055 GGGCTGTGCTTCAGGCAAGGAGG - Intergenic
902733022 1:18382431-18382453 GAGCAGGGCTTTGGGGAAGAAGG - Intergenic
903262923 1:22141044-22141066 TGGGACAGCTTCAGGGAAGGGGG + Intronic
903321109 1:22543679-22543701 GGGCAGAGCTGGTGGGAGGATGG - Intergenic
903853474 1:26321787-26321809 AGCCTGAGCGTCAGGGAAGAAGG + Intergenic
904068862 1:27777179-27777201 GGGTAGAGAGTCAGGGAAGAGGG + Intronic
904483127 1:30806514-30806536 GGGCAGGGCTTCAGAGAGGCTGG - Intergenic
905058799 1:35121763-35121785 GGGCAGAGCGTTAGTAAAGAGGG - Intergenic
905316962 1:37088660-37088682 GGGCACAGCCTCAGGCAAGGGGG + Intergenic
905516326 1:38564642-38564664 TGGCAGAGGTGGAGGGAAGAAGG + Intergenic
906155041 1:43609131-43609153 GGGCAGTGCAGCAGGGAGGAAGG - Intronic
906184488 1:43851227-43851249 GGGCATAGATTCAAAGAAGATGG + Intronic
906204634 1:43980175-43980197 TGGCAGTGCTTCAGGGAGCAGGG - Intronic
906471179 1:46132607-46132629 GGGCAGAGCTTGAGGGCAGTTGG - Exonic
906847238 1:49206376-49206398 GGGCAGAGCCTTAGGAATGAAGG + Intronic
907497556 1:54854931-54854953 GGGCAGAGCTGGAGGGAAGAGGG - Intronic
907517265 1:55000574-55000596 GCTCAGGGTTTCAGGGAAGAAGG + Intronic
908857730 1:68448767-68448789 AGGCAGAGCTGCAGGAGAGAAGG + Intronic
909403070 1:75256280-75256302 AGGTAGACCTTCAGGGAAAAGGG + Intronic
909611695 1:77557658-77557680 GGGGAGAGATTGAGGGATGAGGG - Intronic
910629287 1:89339683-89339705 GGGGATAGCATCAGGGAAGGCGG + Intergenic
910721430 1:90290570-90290592 GGGGAGAGCAGCAGGGAGGAGGG + Intergenic
911391833 1:97255194-97255216 GAGCAAAGCTTCAGGGACAAAGG + Intronic
912195498 1:107392513-107392535 GGGGAGAGTGTCAGGGGAGAGGG + Intronic
912747023 1:112253408-112253430 AGGCAGACCTCCTGGGAAGACGG - Intergenic
912948866 1:114106822-114106844 GGGCACAGCTGCAGGGCAAAGGG - Intronic
912965803 1:114236276-114236298 TGGCAAAGCTTCAGTGAAAAGGG + Intergenic
913400246 1:118423638-118423660 GGGCAGGGCTGCAGGGCAGCTGG + Intergenic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
914920081 1:151840344-151840366 GGGGAGGGCTACAGAGAAGAGGG + Exonic
915597003 1:156901680-156901702 GAGCTGAGGGTCAGGGAAGAGGG + Intronic
916437074 1:164787344-164787366 GGGCAGATCTACAGGGAGGGTGG - Intronic
916455984 1:164971422-164971444 CAGCAGAGCTGCAGGGCAGAAGG + Intergenic
916715631 1:167444587-167444609 AGTCAGAGCCTCAGGGGAGAGGG - Intronic
918708267 1:187695999-187696021 GGACAGAGCTTAATGGAAGATGG + Intergenic
919785994 1:201259166-201259188 GGGCAGAGCTGGAGGGAGGCAGG + Intergenic
919802075 1:201360035-201360057 GGGCACAGCTTCCGGGATGGTGG - Intronic
920038548 1:203081579-203081601 GGTCATAGCTGCAGGGGAGAGGG + Intergenic
921082312 1:211751844-211751866 GGGCAGAAATGAAGGGAAGAGGG - Intronic
921270400 1:213463735-213463757 GGGCAGAGTTTCAGAGAGGAGGG - Intergenic
921306737 1:213804449-213804471 GGAGAGAGCTTCTGGGAAGCAGG - Intergenic
922196670 1:223364853-223364875 GCGCAGAGCTTCGGCGGAGATGG - Intergenic
922225892 1:223645709-223645731 TGGCAGAGCATCAGGGACCAAGG + Intronic
922236502 1:223726428-223726450 GGTCAGGGCTGCAGGGAACAGGG + Intronic
922465540 1:225843755-225843777 GGGCAGAGCTGAAAGGGAGATGG + Intronic
923268555 1:232334892-232334914 AGTCAGAGCTTCAGGCCAGAGGG - Intergenic
923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG + Intronic
923445887 1:234070983-234071005 AGGCAGGGCTTCAGGTGAGACGG - Intronic
923509779 1:234640467-234640489 GGGCAGAGAGGGAGGGAAGAAGG + Intergenic
923986390 1:239387039-239387061 CAGCAGCGCTTCTGGGAAGACGG + Intronic
924115274 1:240739008-240739030 GGGCAGAGTTTCTTAGAAGAAGG - Intergenic
924623996 1:245685426-245685448 GGGGAGAGCTCCTGCGAAGAAGG + Exonic
1063026472 10:2183877-2183899 GGGCTGAGCTACTTGGAAGACGG - Intergenic
1063237658 10:4135125-4135147 GAGCAGTGCTTCAGCTAAGAAGG + Intergenic
1063937420 10:11092732-11092754 GTGAATTGCTTCAGGGAAGAAGG + Intronic
1064065823 10:12180720-12180742 GGGAAGAGCCTCAGGGAGGCTGG - Intronic
1065130146 10:22612419-22612441 GGACAGGGCTTCCAGGAAGAAGG + Intronic
1065309753 10:24403862-24403884 GGGCAGAGATTCAGAGAAACTGG + Intronic
1065854278 10:29816955-29816977 GCGCAGAGCTTTTGGCAAGACGG + Intergenic
1066055188 10:31674150-31674172 CCTCAGAGCCTCAGGGAAGAGGG + Intergenic
1066064125 10:31750108-31750130 CGGCTGGGCTTCAGGGGAGAGGG + Intergenic
1067413020 10:46081353-46081375 AGGGAGAGCATCAGGGAAAATGG - Intergenic
1067462642 10:46469041-46469063 GGGCAGAGGCTCAGGGAGGTGGG - Intergenic
1067515561 10:46938618-46938640 GGGCAGAGTACCAGGGAGGAGGG - Intronic
1067624553 10:47915596-47915618 GGGCAGAGGCTCAGGGAGGTGGG + Intergenic
1067646690 10:48113197-48113219 GGGCAGAGTACCAGGGAGGAGGG + Intergenic
1067697102 10:48543255-48543277 GCTCAGAGCTGCAGGGAAGCGGG + Intronic
1068117472 10:52750765-52750787 GGCTAGAGATTCAGTGAAGAGGG + Intergenic
1068726801 10:60312200-60312222 GGGAGCAGCTTCAGGGAAGGAGG + Intronic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1069752095 10:70751464-70751486 GGGGAGAGCCTGAGGGGAGATGG - Exonic
1070064223 10:73018009-73018031 TGGCTTAGCTTCAGGGATGAAGG - Intronic
1070275345 10:75000756-75000778 GGGCAGTCCTTCATGGAACAAGG + Intronic
1070321694 10:75359354-75359376 GGCCAGAGCCTTAGGGAAGAGGG + Intergenic
1070467434 10:76737753-76737775 GTGCAAAGCTTCAGAGAGGATGG + Intergenic
1070539511 10:77406177-77406199 GGGCAGAGGCTCAGGGACCAGGG - Intronic
1070625949 10:78051237-78051259 GGGCAGAGGTTGAGGGAAATAGG - Intronic
1070763145 10:79037938-79037960 GGGCAGAGCACCAGAGAGGAAGG + Intergenic
1071237329 10:83664296-83664318 GTGCTGAGCTGCAAGGAAGAAGG - Intergenic
1071415553 10:85437669-85437691 GGGCAGGTCTTCCAGGAAGAAGG - Intergenic
1071730433 10:88243292-88243314 CAGCAGAGCTTCAGGGAAAATGG - Intergenic
1072193345 10:93093846-93093868 GGGCAGAGGCCCAGGGAAAAAGG - Intergenic
1073083266 10:100873096-100873118 GTGCAGAACTTTGGGGAAGATGG - Intergenic
1073552271 10:104414592-104414614 TGGGTGGGCTTCAGGGAAGATGG + Intronic
1074219688 10:111424330-111424352 AGGCAGATGTTCAAGGAAGATGG - Intergenic
1075449583 10:122540597-122540619 GGGGAGAGCATTAGGGCAGAAGG - Intergenic
1076119296 10:127922835-127922857 GGGCAGAGGGGGAGGGAAGATGG - Intronic
1076633272 10:131865840-131865862 GGCCAGAGCTGCAGTGAAAATGG - Intergenic
1076808056 10:132869170-132869192 GGGCAGGAGTCCAGGGAAGAGGG + Intronic
1077036392 11:496877-496899 GGGCGGGGCTTCCAGGAAGATGG + Intronic
1077090984 11:777998-778020 GGGCTGAGCTCCTGGGAGGACGG + Intronic
1077173844 11:1180007-1180029 GAACAGAGCTGCAGGGAGGAAGG - Intronic
1077237412 11:1488394-1488416 GGGCAGAGCATAAAGGAAGCTGG + Intronic
1078145767 11:8721045-8721067 GGCCAGGCCTTCAGGGAAGAGGG - Intronic
1080385802 11:31810535-31810557 GGGCTGAGCTCGCGGGAAGAAGG - Intronic
1080826381 11:35852449-35852471 CGGCAGAGCTACAGGGCACAAGG + Intergenic
1080924247 11:36739634-36739656 GAGAAGAGCTTCAGGCAAAAAGG - Intergenic
1081737967 11:45417578-45417600 AGACAGAGGCTCAGGGAAGAAGG + Intergenic
1083164149 11:60873322-60873344 GGGCTGTGCATCAGGGAAGTGGG - Intronic
1083310412 11:61780903-61780925 TGGGAGAGCTTGAGGGGAGAGGG - Intronic
1083776336 11:64895925-64895947 GGGCAGGGCTCCAGGGGAGGTGG - Intronic
1083845978 11:65333868-65333890 AGGCAGAGGAACAGGGAAGATGG + Exonic
1084172818 11:67408872-67408894 GGGCAGAGCTGCAGGAGAGTGGG + Intronic
1084178178 11:67434115-67434137 GGGCAGGGCCCCAGGGCAGAGGG + Intronic
1084467355 11:69333824-69333846 GGGCAGAGAATCAGAGAAGCTGG - Intronic
1084612532 11:70212676-70212698 GAGCAGAGGCTCAGGGAACAGGG - Intergenic
1084619719 11:70261382-70261404 GGGCACAGCCACAGGCAAGATGG + Intergenic
1084733895 11:71092096-71092118 GGGCAGGGCTCCTGGGAAGGGGG + Intronic
1086336871 11:85809857-85809879 GGGCAGAACTTCAGGGGTGGAGG + Intronic
1089457529 11:118634247-118634269 AGGCTGAACTTCAGGGATGAGGG - Intronic
1089561533 11:119345739-119345761 GGGCAGATCTTCCGGGAGAAGGG - Intronic
1089859573 11:121576737-121576759 GGGCAGAGCTCCAGGGACACGGG - Intronic
1090387979 11:126367463-126367485 GGGCAGAGCTTGAATGGAGAGGG + Intronic
1090570428 11:128038771-128038793 GGGCAGACCCATAGGGAAGATGG - Intergenic
1090626007 11:128609422-128609444 GGGCAGAACTTCAAGAAACATGG - Intergenic
1090909366 11:131105120-131105142 AGGCAAAGCTTCAGGGAAGGAGG + Intergenic
1090937182 11:131353670-131353692 GGGCAGAGGCTCTGGGAAGCCGG - Intergenic
1090963517 11:131578456-131578478 GGGGAGAGCTGCAGGGAAGTGGG + Intronic
1091007609 11:131967575-131967597 AGGCAGAGATAAAGGGAAGAAGG + Intronic
1091326165 11:134689829-134689851 GGGCAGAGCTCCTGGGAGGAAGG - Intergenic
1091652193 12:2318838-2318860 GGGCAGAGAGACAGGGAAGGAGG + Intronic
1091741151 12:2960931-2960953 GGGCAGAGCTGGAAGGAAGCTGG + Intronic
1091812228 12:3409266-3409288 TGGCCCAGCTTCAGGGAAGAAGG + Intronic
1092149251 12:6235965-6235987 GGGCAGGACGTCAGGGAAGGAGG - Intronic
1092891822 12:12975934-12975956 GGGCAGAGCTGCAGTGAGTATGG + Intronic
1093146262 12:15570269-15570291 GGTCAGTGATTCAGGGAAAAGGG + Intronic
1094598084 12:31883715-31883737 GGGCAGATCTTGAGGTAAGGAGG - Intergenic
1095278149 12:40315454-40315476 TTGAAGAGCTTCATGGAAGAAGG + Intronic
1095800644 12:46267965-46267987 GGGCAGAGCACCAGGAAGGACGG + Intronic
1096869224 12:54583086-54583108 GGGTAGAGGTACAGGGAAGCGGG + Intronic
1098466639 12:70794643-70794665 GTGCAGAGCTTCAGCCCAGAGGG + Intronic
1098469972 12:70832267-70832289 GGGCAGAGCTTTGGGGCAGCAGG - Intronic
1098764496 12:74469129-74469151 GGGCAGAGCACCTGGGGAGAGGG - Intergenic
1100283524 12:93141077-93141099 GGGCACAGCCTCAGGCAGGATGG + Intergenic
1100437593 12:94585725-94585747 GGGAAAAGCTTCATGGCAGAAGG - Intronic
1100676939 12:96878520-96878542 GGGCAGAGATGTTGGGAAGAAGG - Intergenic
1100981596 12:100166650-100166672 GGGCAGGGGTTCAGGTAAGAAGG + Intergenic
1101237690 12:102806122-102806144 GGGGAGAGCTGGGGGGAAGAAGG - Intergenic
1101327854 12:103732436-103732458 GGGTTGAGTATCAGGGAAGAGGG - Intronic
1101519488 12:105468378-105468400 GGGCAAAGATTCAGGGGATATGG - Intergenic
1101880084 12:108620278-108620300 GGGCTGAGTTTCACGGAATATGG + Intergenic
1102773897 12:115502270-115502292 GGGCAGGGATTTAGCGAAGATGG + Intergenic
1104135473 12:125933768-125933790 GGGAAGTGTATCAGGGAAGAAGG - Intergenic
1104375119 12:128259060-128259082 TGCCAGAGCCTCAGGGAAGCTGG + Intergenic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1105655621 13:22434310-22434332 AGCCAGAGCTTCAGGGAAAATGG + Intergenic
1105739119 13:23303570-23303592 GGGCACAGGATCAGAGAAGAGGG + Intronic
1105747424 13:23391328-23391350 GGGCAGAGCCTCAGGGGCAAAGG - Intronic
1106003862 13:25750491-25750513 GGGCAGAGCAACATGGAAGCAGG - Intronic
1106032827 13:26018089-26018111 GGGCTGAGCAGCAGGGAGGAGGG - Intronic
1107043587 13:35973389-35973411 GGGGAGAGCTTCCCAGAAGAGGG - Intronic
1107579445 13:41766671-41766693 AGGCAAAGCTTCAGAGAAGTTGG - Intronic
1107592230 13:41920280-41920302 TGGCATGGCTCCAGGGAAGAAGG - Intronic
1108682928 13:52794689-52794711 GGAAAGAGCTTCAAGGAAGATGG - Intergenic
1109694344 13:65933824-65933846 GGTCAGAGCATCTGGGAATATGG - Intergenic
1111947801 13:94683589-94683611 GGGAAGAGTTTCAGGAAGGAGGG + Intergenic
1112563336 13:100532594-100532616 GGGCAGAGCTGCAGGGAGAGGGG + Exonic
1113663759 13:112126333-112126355 GGGGCTAGCTTCAGGAAAGAAGG + Intergenic
1114260106 14:21030433-21030455 GGAGAGAGCAACAGGGAAGAGGG + Intronic
1114560952 14:23589937-23589959 GAGCAGAGGATGAGGGAAGAAGG + Intergenic
1117497291 14:56318322-56318344 GGGCAAATCATCAGGGAAAAAGG + Intergenic
1117661656 14:58012556-58012578 GGGCAGAGATTAAGGGAGGAAGG + Intronic
1118088124 14:62441838-62441860 TGGCAGAGCCTCAGGGATGGAGG + Intergenic
1118682624 14:68259153-68259175 GGGCAGAGCTTTGTGGAAGCTGG - Intronic
1120067678 14:80063065-80063087 GGGCAGATGTCCAGAGAAGAGGG - Intergenic
1122116690 14:99531135-99531157 GGGCACAGCGTGGGGGAAGAGGG + Intronic
1122117940 14:99536940-99536962 GGGCAAACCCTCAGGGCAGAGGG + Intronic
1122201875 14:100127743-100127765 GGCCAGAAGTTCATGGAAGACGG - Intronic
1122246143 14:100404820-100404842 GGCCAGAGCTGCAGGGGAGAGGG - Intronic
1122270056 14:100564990-100565012 GGGAAGAGCTTCCGGGAAGCAGG - Intronic
1122371004 14:101229026-101229048 AGGCAGAGCTGCAGGGCACAGGG - Intergenic
1122580105 14:102766296-102766318 GGACCCAGCTCCAGGGAAGATGG + Intergenic
1122604532 14:102939444-102939466 GAACAGAGCTTCAGCGGAGACGG + Intronic
1122692244 14:103536903-103536925 GGGCAGAGCAGCAGGGCCGAGGG - Exonic
1122741160 14:103872222-103872244 GGACACAGCATCAGAGAAGAAGG - Intergenic
1122917899 14:104867218-104867240 GGGCAGAGGGACAGGGCAGAGGG - Intronic
1122986507 14:105214120-105214142 GGGCCGAGCTTCAGCCAAGCGGG - Intronic
1124908884 15:33898563-33898585 GGACAGAGACACAGGGAAGAAGG - Intronic
1125933494 15:43616186-43616208 GGGCAGGCCTTCAGGGCAGCTGG + Exonic
1125946592 15:43715648-43715670 GGGCAGGCCTTCAGGGCAGCTGG + Intergenic
1127619978 15:60724628-60724650 GGCCACAGCATCAGAGAAGATGG - Intronic
1128210768 15:65900103-65900125 TAGCAGAGCTTCACAGAAGAAGG - Intronic
1128468590 15:67933208-67933230 TGGCCTTGCTTCAGGGAAGAAGG - Intergenic
1128752799 15:70161160-70161182 GGGCAGTGCTTCTCGGAGGAGGG + Intergenic
1129973982 15:79805627-79805649 GGGCTGTGCTTCAGGGGAAATGG + Intergenic
1130543059 15:84835713-84835735 GGGCAGGATTTCAGGAAAGATGG - Intronic
1130602671 15:85287405-85287427 GGGCAGAGCCACAGGATAGAAGG + Intergenic
1130770119 15:86915853-86915875 GAGCAGAGCTGCAGGAAAGCAGG + Intronic
1132279807 15:100602827-100602849 GGGCAGAGGTGCAGGGAGGCAGG - Exonic
1132535131 16:475150-475172 GGAGAGAGGCTCAGGGAAGAAGG + Intronic
1132744621 16:1431552-1431574 GGGGAGGGCTTCAGGGAGGGAGG - Intergenic
1132758773 16:1498961-1498983 GGGCTGAGGTGCAGGGAAGGAGG + Intronic
1132909401 16:2300746-2300768 GGGCAGAGCAGCAGGGAAGGTGG + Intronic
1133270385 16:4608476-4608498 GGGCAGGGCCTCTGGGCAGAGGG - Intergenic
1133270771 16:4609927-4609949 GGTGAGAGCGTCAGGGAAGTTGG + Exonic
1133477611 16:6138536-6138558 GGGCAAATCTGCTGGGAAGATGG + Intronic
1133893324 16:9902405-9902427 TGGCAGAGCCACAGGGTAGAAGG + Intronic
1135732531 16:24906926-24906948 AGGCAGAACCTCAGGGAGGACGG - Intronic
1136630244 16:31485670-31485692 GGTCAGATCCTCAGGGATGAGGG + Intronic
1136636720 16:31528998-31529020 GTGCAGAGCTGCAGGGGAGGGGG + Intergenic
1136655208 16:31705506-31705528 GGGCAGAGGGGCAGGGAACAAGG + Intergenic
1136748635 16:32614039-32614061 GGGCAGAGCCTCTGGGCAGCTGG + Intergenic
1139475957 16:67202675-67202697 CGGAAGAGCTCCAGGGAAGTGGG - Exonic
1139532469 16:67549149-67549171 GGGCAGAGTCTCAGAGATGATGG - Intergenic
1140050687 16:71478619-71478641 GTGCAGAGCCTCTTGGAAGATGG + Intronic
1140475654 16:75238221-75238243 AGGGAGACCTTCAGGGAAGGAGG - Intronic
1141498728 16:84428958-84428980 GGGCATATATTCAGGGAAAAAGG - Intronic
1141688448 16:85583289-85583311 TGGCAGAGCTGCAGGGCACAGGG - Intergenic
1141718174 16:85739038-85739060 GGACAGAGCTTCCAGGAACAGGG + Intronic
1141950389 16:87335697-87335719 GGGCAGAGCTTTAGGTGGGAGGG + Intronic
1141955661 16:87369945-87369967 GGGCACAGCTTCAGTGTAGCTGG - Intronic
1203050768 16_KI270728v1_random:873253-873275 GGGCAGAGCCTCTGGGCAGCTGG + Intergenic
1142590495 17:1003345-1003367 GGGCAGAGCTGCGGGGAGGTGGG - Exonic
1142616759 17:1141057-1141079 GGGCACAGTATCAGGGCAGAAGG + Intronic
1142645017 17:1305980-1306002 GGTCAGAACTTCAGGGGAGAGGG + Intergenic
1143828373 17:9631223-9631245 AGGAAGAGCTCCAGGTAAGAAGG - Intronic
1143838491 17:9712041-9712063 GGGCAGAGCTCCAGGACAGCAGG - Exonic
1143906631 17:10214367-10214389 GGGCAGAACTTCAGGAATTAGGG + Intergenic
1144867704 17:18347502-18347524 GGGCATAGATTCAAAGAAGATGG + Exonic
1144889896 17:18488699-18488721 GGGGAGAGAGTCAGGGAAGGAGG - Intronic
1145035455 17:19537461-19537483 GGGAAGACCTACAGGGAAGGTGG + Intronic
1145142318 17:20455618-20455640 GGGGAGAGAGTCAGGGAAGGAGG + Intronic
1145264009 17:21370834-21370856 GGACAGAGCTTCCAGGAAGGCGG - Intergenic
1145793592 17:27643283-27643305 GGGGAGAGAGTCAGGGAAGGAGG - Intronic
1146655831 17:34634686-34634708 TTGCAGAGCTTCTGGGAAGCTGG + Intronic
1146671561 17:34741439-34741461 GGGCACAGCTTTAGTGGAGAAGG + Intergenic
1147137240 17:38441427-38441449 GGGAAGAGGTTAAGGGAGGAGGG - Intronic
1147236328 17:39060281-39060303 GGCCAGAGGTGCAGGGAGGAAGG - Intergenic
1148026372 17:44591713-44591735 GGGTAGAGATTCAGGCAGGAAGG - Intergenic
1148227225 17:45907301-45907323 GGGGAAAGCTTCGGGGAAGATGG - Intronic
1148854485 17:50571210-50571232 GGGAATAGTTTCAGGGAAGCAGG + Intronic
1148855061 17:50574525-50574547 GGCCAGTGCTTCAGGGAAGTGGG + Intronic
1149661334 17:58335545-58335567 GGGCAGAGCTTCAGGTCTGATGG + Intergenic
1149974345 17:61251039-61251061 GGGCAGGGCTGGAGGGATGAGGG - Intronic
1150295163 17:64003485-64003507 GGAAAGAACTTCAGGGAAGAGGG + Intronic
1150508790 17:65726412-65726434 CAGCAGAGCTTCATGGAGGAGGG + Intronic
1151026341 17:70682010-70682032 GGGCAGAGGTACAGGAAATATGG - Intergenic
1151207382 17:72517946-72517968 TGGCAGAGGCCCAGGGAAGAGGG + Intergenic
1151978130 17:77493728-77493750 GGACAGAGACACAGGGAAGAAGG - Intronic
1152094205 17:78263661-78263683 TGGCAGAGCGTCATGGAAGGTGG + Intergenic
1152222833 17:79078535-79078557 GATCAGAGCTTAAGGGAAGAAGG - Intronic
1152264928 17:79288608-79288630 GGGCAGAGCCTCTGGGATGACGG - Intronic
1152614001 17:81329669-81329691 GGGCAGGGGTGCAGGGCAGATGG - Intronic
1152655260 17:81516492-81516514 GGAAAGAGCTTCAGGAAACAGGG - Intronic
1152754561 17:82081864-82081886 GGGCAGAGCTGCGGGGAGGTCGG + Intronic
1152929431 17:83102286-83102308 AGGAAGAGCTTCAGGGCAGTAGG + Intergenic
1153834098 18:8949058-8949080 GGGCGGAGCTGCAGGGGTGAGGG + Intergenic
1154360315 18:13655322-13655344 GGCCAGGGCTTCAGGGCAGTAGG + Intergenic
1155117484 18:22783899-22783921 GGACAGAGCCCCAGGGAGGAGGG - Intergenic
1155611819 18:27674658-27674680 GGGAAGAGCTTCAAGGCACAAGG - Intergenic
1156053924 18:32974674-32974696 TGACAGAGCTAAAGGGAAGAGGG + Exonic
1156398238 18:36718156-36718178 GGGCTCAGCATCAGGGGAGATGG - Exonic
1156450953 18:37266308-37266330 GGGCAGAACTTCAGGCAAGTGGG - Intronic
1156910013 18:42400561-42400583 GGGCAGAGCTACAAGATAGAAGG + Intergenic
1156917887 18:42483310-42483332 GAGCAGGGCTCTAGGGAAGAAGG - Intergenic
1157191217 18:45583323-45583345 AGACAAAGCTTCAGGGAGGAAGG - Intronic
1157502765 18:48202780-48202802 GGGTAAAGCTGCAGGGGAGAGGG - Intronic
1158352144 18:56573774-56573796 GGGCATAGATTCAGGGAGGACGG + Intergenic
1158519931 18:58163432-58163454 CTGCAGCGCTTCAGGGAACAGGG + Intronic
1158956339 18:62543301-62543323 GGGCAGAGTATCATGGATGAAGG - Intronic
1159712080 18:71773534-71773556 GGGCAGACATTGAGGAAAGAGGG - Intronic
1160178640 18:76615884-76615906 GGGCAGGGAGTCAGGGAAGGTGG + Intergenic
1160462372 18:79048734-79048756 GGGCAGAGCCTCTGGGAGAAAGG + Intergenic
1160794810 19:940417-940439 GGGCAGAGCTTGAGGGCACTTGG + Intronic
1161290622 19:3491804-3491826 GTGCAGACCTGCAGGGGAGAGGG + Exonic
1161385142 19:3987674-3987696 GGGGAGAGCTTAAGGGAAAAAGG + Intergenic
1161410959 19:4117245-4117267 GGGCCCAGCTTCTGGGCAGATGG - Intronic
1161509416 19:4662370-4662392 GGGCCAAGGATCAGGGAAGAAGG + Intronic
1161701970 19:5800622-5800644 GGGCAGAGGTTCTGGGAGGCCGG - Intergenic
1161956241 19:7497041-7497063 GTGCAGTGATTCAGGGAAGTGGG + Intronic
1162937315 19:13987603-13987625 TGGCAGAGGGTCAGGGAGGAAGG + Intronic
1163129929 19:15265995-15266017 AGGCAGTGCTTCTGGGAACAAGG - Intronic
1163254011 19:16143893-16143915 GGGGAGAGCTTCGTGGAGGAGGG + Intronic
1163641444 19:18464702-18464724 GTGCCGGGCTTCAGGGAGGAGGG - Intronic
1164441147 19:28281842-28281864 GAGAAGAGTGTCAGGGAAGAAGG - Intergenic
1164799935 19:31067993-31068015 AGACAGGGCTTCAGGGAGGAAGG - Intergenic
1164932038 19:32183351-32183373 GTGGAGAGCTTCAGTGAACATGG - Intergenic
1164966597 19:32490062-32490084 GGGCAGAGCACCAGAGAGGAGGG + Intergenic
1165135622 19:33666552-33666574 AGGCTGGGCATCAGGGAAGAGGG + Intronic
1165150066 19:33754969-33754991 GGGCTGAGCTGCTCGGAAGAAGG - Intronic
1166066847 19:40365121-40365143 TGGGGGAGCTTGAGGGAAGAGGG + Intronic
1166560776 19:43731233-43731255 GGGCTTAGAGTCAGGGAAGAGGG + Exonic
1166645801 19:44530776-44530798 AGGGAGAGCTTCCTGGAAGAGGG + Intergenic
1166752366 19:45170400-45170422 GTGCTGAGCCTGAGGGAAGAGGG + Intronic
1166976732 19:46609326-46609348 GGAGAGAGACTCAGGGAAGAAGG - Exonic
1167278822 19:48554442-48554464 GGGCAGAGAGTCAGGGGACAGGG - Intronic
1167315754 19:48761920-48761942 GGGCAGAGACCCAGGGAAAAAGG + Intergenic
1167521389 19:49958244-49958266 GGGCTGAGGTTCAGGGAGAAAGG - Intronic
1167674122 19:50874081-50874103 GGGCAAAGAGTCAGGGAAGGAGG - Intronic
1167981905 19:53282611-53282633 GGGCGGAGCTTCCTGGAAGTGGG + Intergenic
1167984188 19:53301051-53301073 GGGCGGAGCTTCCTGGAAGTGGG - Intergenic
1168335254 19:55593516-55593538 GGGCCGGGCTGCAGGGGAGAGGG + Exonic
925064457 2:918843-918865 CGGCAGAGCATCTGGGAAGGGGG + Intergenic
925555582 2:5127818-5127840 GGGCAGAGCTCCATGACAGATGG + Intergenic
926198643 2:10778222-10778244 GGGCAGAGCCTCTGAGAAGGTGG + Intronic
928394948 2:30936293-30936315 GGGCAGGAATTCAGGGGAGAAGG + Intronic
928415645 2:31089559-31089581 GGACCAAGCTTCAGGGAAGTTGG - Intronic
929450300 2:42032514-42032536 GGGCAGAGTCTCAAGGAAGGGGG + Intergenic
930426511 2:51219545-51219567 GGGCAGAGGCCCAGAGAAGATGG - Intergenic
930912144 2:56641815-56641837 GGGGAGAGGTTCAGGGAGAATGG + Intergenic
930996430 2:57724383-57724405 TTGCAGAGCTTGAGAGAAGAGGG - Intergenic
931153623 2:59602919-59602941 GGGCAGGGCTCCAGGGAGGAGGG - Intergenic
931285856 2:60830950-60830972 GGGCAGGGCATCAGGAATGAGGG - Intergenic
931859924 2:66344402-66344424 TGGCAGAGCTTCAAGAGAGAGGG - Intergenic
932396842 2:71454440-71454462 GACCAGACCTTCAGGGGAGAAGG - Intronic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
933692598 2:85190913-85190935 TGGCAGAGCTTCAGTGGAAACGG + Intronic
935645450 2:105330030-105330052 GCGGGGAGCTTCAGGGAAGCCGG + Exonic
935855679 2:107270344-107270366 GAGCAGAGTCTGAGGGAAGAGGG + Intergenic
936267927 2:111024371-111024393 GAGCAGAGACTCATGGAAGAAGG + Intronic
937087938 2:119184126-119184148 GGGCAGAGCAGAAGGGTAGAAGG - Intergenic
937157931 2:119734395-119734417 GGACTGGACTTCAGGGAAGATGG - Intergenic
937651167 2:124320944-124320966 GGGTTGAGTTTAAGGGAAGATGG + Intronic
938062054 2:128261960-128261982 GGGCAGGGCTGCATGGAAAACGG + Intronic
939465016 2:142545704-142545726 GGGCAGAGTCTCTGGCAAGAGGG - Intergenic
940331829 2:152483620-152483642 GGGCTTAGCATCAGGGAAGGAGG - Intronic
940885300 2:158984709-158984731 GGGGAAAGCTTCAGGGAGGAGGG + Intronic
940985741 2:160050322-160050344 GGGCAGTGCTGGAAGGAAGACGG + Intronic
941179768 2:162244982-162245004 GGGCAGAACTTCTGAGAACACGG - Intronic
941650781 2:168090382-168090404 GGGGAAAGCATGAGGGAAGATGG - Intronic
943669007 2:190640998-190641020 GGACAGATCTGCAGGGAAAAGGG - Intergenic
943736726 2:191364685-191364707 GAGCAGAGGGTCAGGGAAAAAGG + Intronic
944083107 2:195812183-195812205 GGGCAGGGCGTTAGGGAGGAGGG - Intronic
944748198 2:202679377-202679399 GGACAAAGTTTCAGAGAAGAGGG + Intronic
944981727 2:205128341-205128363 GGGCATAGCTTCTAGGAAGAAGG - Intronic
945039689 2:205733572-205733594 GGGGAGAGATTGAGGGAACAGGG - Intronic
945431754 2:209772426-209772448 GGGCAGAGAGCCTGGGAAGAGGG + Intronic
946028941 2:216690299-216690321 GGCCAGAGCAGAAGGGAAGAGGG - Intronic
946364270 2:219238872-219238894 GGGAAGGGCTTCAGGGATCATGG + Intronic
946396580 2:219446411-219446433 GGGAAGAGCCTCTGGGAAGTGGG - Intronic
946451372 2:219782872-219782894 GTGCAGAGGATCAGGGGAGAGGG + Intergenic
946913040 2:224485644-224485666 GGACAGAGCACCTGGGAAGAAGG + Intronic
947847818 2:233259738-233259760 GGGAAGATCTAGAGGGAAGAAGG - Intronic
948033623 2:234840092-234840114 GGGCAGAGCTCTGGAGAAGATGG + Intergenic
948050734 2:234977483-234977505 GAGCAGAGCTGCAGGGACAATGG + Intronic
948396440 2:237648684-237648706 GGGGATAGTTTCTGGGAAGATGG - Intronic
948942704 2:241204112-241204134 GGGCACAGCATCGGGGCAGAGGG + Intronic
948995479 2:241576166-241576188 GAGTAGAGCTGCAGGGAAGGAGG - Intergenic
949043470 2:241859661-241859683 GGGCAGGGCCCCGGGGAAGAAGG - Intergenic
1169442576 20:5644931-5644953 GGGAAGAGCTTCTAGGATGAAGG - Intergenic
1169606667 20:7328578-7328600 TGGCAGAGCTGCAATGAAGAGGG + Intergenic
1170489737 20:16861049-16861071 TAGCAGAGCTTCAGAGAAGGTGG + Intergenic
1170830513 20:19835662-19835684 GGCCCGAATTTCAGGGAAGACGG - Intergenic
1170985823 20:21257306-21257328 GGGAAGGACTTCAGGGAAGAGGG + Intergenic
1172215333 20:33231689-33231711 CGGGAGGGCTCCAGGGAAGATGG + Intergenic
1172578845 20:36030886-36030908 GGGCATAGGTTCAGGGTAGGAGG + Intergenic
1172778363 20:37421244-37421266 AGGCAGAGCCCAAGGGAAGAAGG - Intergenic
1172903278 20:38350384-38350406 GGAAACAGATTCAGGGAAGATGG - Intronic
1173223775 20:41149824-41149846 GGGCAGAGCTTCAAGGAGAGAGG + Intronic
1174079982 20:47963694-47963716 GCACAGAGCTTCAGGGATGCAGG - Intergenic
1174795557 20:53519575-53519597 AGGCAGAGTTTCGGGGAAGTAGG + Intergenic
1175268754 20:57719051-57719073 GGGCAGAGCAGTGGGGAAGAAGG - Intergenic
1175533875 20:59693838-59693860 AGGCAGAGCCCCAGGCAAGAGGG + Intronic
1175711551 20:61225384-61225406 GGGCAGAGCTCCAAGGGACAAGG + Intergenic
1176084629 20:63290339-63290361 GGGCAGCGCTTTAGGGCAGGTGG + Intergenic
1176427235 21:6556087-6556109 GGGCAGAGCTACAGGGCTGCTGG + Intergenic
1176864451 21:14037238-14037260 GGCCAGACCTGTAGGGAAGAAGG + Intergenic
1178730178 21:35094817-35094839 GGGCAGAGGGTGGGGGAAGAAGG - Intronic
1179535439 21:42048529-42048551 GGGCGGAGGTTCGGGGAACAGGG + Intergenic
1179702726 21:43164405-43164427 GGGCAGAGCTACAGGGCTGCTGG + Intergenic
1179708436 21:43195626-43195648 GAGCAGCGCTTCAGGGAGGAGGG + Intergenic
1179984706 21:44913950-44913972 CGGCAGAGCTGCAGGGCAGGAGG + Intronic
1179988010 21:44931990-44932012 GGGGAGCGCCTCAGGGAAGGAGG - Intergenic
1179991861 21:44952505-44952527 GGCCAGACCTGCAGGGGAGAAGG - Intronic
1180034402 21:45236311-45236333 GGGCAGACCTTCAGGGCACTGGG + Intergenic
1180065570 21:45410463-45410485 GGCCAGAGCCACAGGGAGGAAGG + Intronic
1180145333 21:45915536-45915558 AGTCACAGCTCCAGGGAAGAGGG + Intronic
1181013406 22:20055055-20055077 GGGCAGCACTTCGGGGAGGAAGG + Intronic
1181511516 22:23391280-23391302 GGGGAGAGAATCGGGGAAGAGGG - Intergenic
1181647910 22:24243720-24243742 GGGCTGGGCTTCCTGGAAGAGGG + Intronic
1181668967 22:24416928-24416950 GTGCAGAGCTGCAAGGGAGAGGG + Exonic
1181797467 22:25320436-25320458 GGGTTGAGCTGCAAGGAAGAAGG - Intergenic
1181862541 22:25830005-25830027 GGTCACACCTTCAGGGAAGAAGG - Intronic
1182300507 22:29334403-29334425 AGCCAGACCTGCAGGGAAGAGGG + Exonic
1182602348 22:31475956-31475978 GGGGAGGGGTTCAGGGAGGATGG + Intronic
1183376492 22:37468325-37468347 GGTCAGAGAATCAGGGAAGGCGG - Intergenic
1183574086 22:38675915-38675937 GGGCAGTTCTGCAGTGAAGAAGG + Intergenic
1184060804 22:42079832-42079854 GGGCCTAGCTTGAGGAAAGATGG + Exonic
1184285494 22:43468792-43468814 GGGTCCAGCTTCAGGGAAGAAGG + Intronic
1184430166 22:44437879-44437901 GGGCAGAGGCTCAGGGAGGTGGG + Intergenic
1184443972 22:44536344-44536366 GAACAGAGCTGCTGGGAAGATGG - Intergenic
1184628025 22:45753162-45753184 GGGGAGGGGTTAAGGGAAGAGGG - Intronic
1184645064 22:45891083-45891105 GGCCAGAGCTCCTGGGAGGAAGG - Intergenic
1184848441 22:47103310-47103332 GGCCAGGGCTCCTGGGAAGAAGG + Intronic
1185239381 22:49734543-49734565 GGCCAGGGCTCCAGGGGAGAAGG + Intergenic
950468291 3:13168713-13168735 GGACAGATCTTCCAGGAAGACGG - Intergenic
951194353 3:19807074-19807096 TGGCAAAGCTTCAGAGAAAAGGG + Intergenic
951787739 3:26441707-26441729 GGTGAGAGATTCAGGGAAGCTGG - Intergenic
952272139 3:31843501-31843523 AGGCAGAGCCTCAGGGATGAAGG - Intronic
953432523 3:42851543-42851565 GGGCACAGGTGCTGGGAAGAGGG + Intronic
954196008 3:48997639-48997661 GGGCAGAGCATCAGACAAAAGGG - Intronic
956525580 3:70156067-70156089 AGGCAGGGATTCAGGGCAGAGGG - Intergenic
957025583 3:75178157-75178179 AGGCAGAGCTTGATGAAAGAAGG + Intergenic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
957887891 3:86314182-86314204 GGGCTGAGCTGCAGGAAAAATGG - Intergenic
960056476 3:113279648-113279670 GAGCTGAGCTGCAGGGGAGATGG - Intronic
960249156 3:115433311-115433333 TAGCAGAGCTCCAGAGAAGAAGG + Intergenic
960953356 3:123013809-123013831 GGGAAAGGCTTCAGGGAAGAGGG + Intronic
961092079 3:124121906-124121928 GCACATTGCTTCAGGGAAGATGG + Intronic
961134572 3:124497859-124497881 AGTCAGAGCTGCTGGGAAGATGG - Intronic
961334113 3:126159963-126159985 GGGCAGGGCTTAAGGATAGAGGG - Intronic
961815632 3:129548726-129548748 GGGCAGCGCTTCAGGGTAGTGGG + Intronic
962429792 3:135308429-135308451 TGGCAGAGCCTCAGGCAGGAAGG - Intergenic
963607675 3:147424784-147424806 GGGCAGACCTGGAGGGAGGAGGG - Intronic
965603239 3:170475002-170475024 GGGCAGAGTCTCAGGGAACATGG - Intronic
967122416 3:186394715-186394737 TGGCAAAGCTTCAGAGAAAAGGG + Intergenic
967740516 3:192998083-192998105 GGCCAGAGTTCCAGGGAAGCTGG - Intergenic
968043920 3:195612793-195612815 GGGCTGTGCTGCTGGGAAGAAGG - Intergenic
968933236 4:3595478-3595500 GGGCAGAGGATCAGAGAGGAGGG - Intergenic
969112898 4:4854709-4854731 GGGCAGAGCTGGAGGGGAGAAGG + Intergenic
969584699 4:8084993-8085015 GGGCAGAGCTTCAGGGACACAGG + Intronic
969663175 4:8542305-8542327 GACCAGAGCCTCATGGAAGACGG + Intergenic
969884668 4:10204742-10204764 GGGCAGTTCTTCAGGGACCAAGG + Intergenic
970522854 4:16903007-16903029 GGGCAGGGCTTCAGGGACAGGGG - Intergenic
970814165 4:20134244-20134266 AGGCAGAGCTGGAGGGGAGAAGG + Intergenic
971031478 4:22642115-22642137 GGGCAGAGTTAAAGGGAAAAAGG + Intergenic
971587612 4:28424471-28424493 TGGCAGGGCTTCAGAGAAAAGGG + Intergenic
972419573 4:38873937-38873959 GGGAAGAGCTGCAGTGAACAGGG + Intronic
972893459 4:43589036-43589058 GGCCAGAGCAACAGGGAAGCAGG + Intergenic
973677994 4:53286045-53286067 TGGCAGAGCCTCAGGGATGATGG - Intronic
974148282 4:57972941-57972963 GGGCAGATCATCAAGGAACATGG + Intergenic
975622916 4:76312060-76312082 TGGCAGAGCCACAGGGCAGAAGG - Intergenic
976281965 4:83334693-83334715 GGGCAGGGCGCCAGGGGAGAGGG + Exonic
976619338 4:87112319-87112341 GGGCAGAGAGGGAGGGAAGAAGG - Intronic
977299524 4:95252418-95252440 GGGCTGCTCTTCAGAGAAGAGGG - Intronic
978042773 4:104090715-104090737 GGACAGGGCTTAAGGAAAGATGG + Intergenic
979085397 4:116403523-116403545 GGGCAGAGGTGCAGAGAAGAGGG + Intergenic
981031662 4:140131661-140131683 GGGGAGAGCTAGATGGAAGAGGG - Intronic
981263870 4:142757441-142757463 GCCAAGAGTTTCAGGGAAGAAGG - Intronic
982486709 4:155975142-155975164 GGACAAAGATTCAGGGAAAAGGG + Intergenic
983728715 4:170965990-170966012 TGCCAGAGCTTCAGCCAAGACGG + Intergenic
984242699 4:177236793-177236815 GGGCTGAGCTTGAGAGCAGAGGG + Intergenic
984571475 4:181399592-181399614 GGGGAGGACTTCATGGAAGAAGG + Intergenic
984878612 4:184391027-184391049 GGACAGAGCTGCAGTGAGGAGGG - Intronic
985007127 4:185545010-185545032 AGGCAGAGCTTCAGGGACTATGG - Intergenic
985383392 4:189419485-189419507 GAGGAGCACTTCAGGGAAGACGG + Intergenic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
986796808 5:11220533-11220555 GGGCAGGGGTCCAGGGAAAATGG - Intronic
987277214 5:16374652-16374674 AGGGAGAGCTTCCGGCAAGAGGG - Intergenic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
990535338 5:56716070-56716092 GGGGAGAGCCTCAGAGAAGCAGG + Intergenic
991509456 5:67360687-67360709 GGGGAGAGCTTCAAGAAGGAAGG + Intergenic
992222507 5:74586758-74586780 GGGAAAAGCTTCAGAGAATATGG - Intergenic
992656656 5:78917042-78917064 GGGCAGACCATGAGGGAAAAGGG + Intronic
992758601 5:79932222-79932244 TGGCAGAGGCTGAGGGAAGAGGG + Intergenic
993473068 5:88330659-88330681 GGGCAGAACTACAAGGTAGAAGG - Intergenic
995519967 5:112993752-112993774 TGGCAGTCCTTCAGGGAAAAGGG - Intronic
996853460 5:127978445-127978467 GGACAGAGCTTCAGGTTAAATGG + Intergenic
997828516 5:137129179-137129201 GGCCTGTGCTTCAGGAAAGAAGG - Intronic
999121541 5:149213377-149213399 GGACAGAGCTTCAGAAAACATGG + Intronic
999697358 5:154198851-154198873 GGGCAAGGCTGCAGGGAAGAAGG - Intronic
999803694 5:155062094-155062116 GGGCAGTGCTTTAGGCAACAAGG - Intergenic
1000028196 5:157378108-157378130 GGTAAGAGGGTCAGGGAAGAAGG + Intronic
1000046400 5:157525348-157525370 GGGCAGAGTCTCAGGGAGGTGGG - Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000413998 5:160964469-160964491 GTGGAGAGCTTGAGGGAATATGG - Intergenic
1001990511 5:176112414-176112436 GGGCAGAGCCTCTGGGCAGCTGG + Intronic
1002187230 5:177460000-177460022 GGGAAGAGCTTCAGGAGAGGCGG + Intronic
1002226361 5:177725726-177725748 GGGCAGAGCCTCTGGGCAGCTGG - Intronic
1002267486 5:178045487-178045509 GGGCAGAGCCTCTGGGCAGCTGG + Intronic
1002294523 5:178222905-178222927 GGGCAGAGACTCAGCGAAGAAGG + Exonic
1002408620 5:179055515-179055537 AGTTAGAGCTTCAGGGAAGTGGG + Intergenic
1003247057 6:4391360-4391382 GGGATGAGGTTCAGGGATGAAGG + Intergenic
1003351660 6:5323682-5323704 GGGAAGAGCTGGAGGGAAGCTGG + Intronic
1003513420 6:6800151-6800173 GGTAAGAGCTTCAGAGCAGAGGG - Intergenic
1004044169 6:12010892-12010914 GGACCGGGCTCCAGGGAAGAGGG - Intronic
1004204747 6:13582000-13582022 GGGGAGAGGTTCATGGAAGTGGG - Intronic
1004344113 6:14832571-14832593 GGGCAGAGCTTCTGGAAACGTGG - Intergenic
1004676006 6:17842897-17842919 GGTCAGAGTTTCAGGGGAAACGG - Intronic
1004859710 6:19790325-19790347 TGGCCGAGTTTCAGGGAAAAAGG + Intergenic
1004889385 6:20084877-20084899 GGGCACACATTCCGGGAAGAAGG - Intergenic
1004932325 6:20474614-20474636 GGGCTGAGCACCAGGGTAGATGG - Intronic
1006170977 6:32092422-32092444 GAGAAGTGCTTCTGGGAAGAGGG + Intronic
1006320588 6:33317404-33317426 GGGCATAGCCTGAGGGGAGATGG - Intronic
1006459014 6:34147371-34147393 GGGCAGAGCTGCTGGGCAGCAGG - Intronic
1006709113 6:36049962-36049984 GGGCAACTCTTGAGGGAAGAGGG + Intronic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007798708 6:44373136-44373158 GGGCAGAGTTCTGGGGAAGAAGG - Intronic
1007827313 6:44610262-44610284 AGGCAGAGCATCAGGGGAGAAGG + Intergenic
1008074179 6:47128666-47128688 AGGCAGACCTTCAGAGCAGAAGG - Intergenic
1010334678 6:74666618-74666640 GGGCACAGATACAGGTAAGATGG - Intergenic
1010465264 6:76160629-76160651 GGGAAGATCTTCAAGGCAGAGGG + Intergenic
1011120987 6:83952424-83952446 TATCAGAGCTTCATGGAAGAAGG + Intronic
1012244494 6:96911537-96911559 GGGAAGAGATTCGGGGTAGAAGG - Intergenic
1013294553 6:108747150-108747172 GGGCAGAGAGTCGGGGGAGAGGG + Intergenic
1013988068 6:116220364-116220386 TGGCTGAGCTCCAGGGCAGATGG - Intronic
1015818193 6:137231699-137231721 GGGCATAGCTTCAGGAATGGGGG - Intergenic
1016079075 6:139833756-139833778 GGGCAGAGTTTATGGGAACAGGG + Intergenic
1016743975 6:147558602-147558624 GGGCAGAGTTTCTAGGAGGACGG - Intronic
1017072158 6:150585026-150585048 GGGCAAAGCTCCTGCGAAGACGG - Intergenic
1017712187 6:157180907-157180929 GGGCAGAGGGAGAGGGAAGAAGG - Intronic
1017771961 6:157650797-157650819 GGGCAGAGCTCAAGGGAAACAGG - Intronic
1018111890 6:160544478-160544500 GGGGAGAGCAAGAGGGAAGAAGG - Intronic
1018784739 6:167099152-167099174 AGGCCAAGCTGCAGGGAAGAAGG + Intergenic
1018923911 6:168193801-168193823 GGGCAGAGCTGCTGGGAAGAAGG + Intergenic
1019488490 7:1300316-1300338 GGGCAGAGCTTCCTGGCAGGCGG + Intergenic
1019625814 7:2015127-2015149 GGGCAGAGGTCCCAGGAAGAGGG - Intronic
1019671009 7:2278298-2278320 CGGCAGATCTGCAGGGGAGATGG + Exonic
1019772049 7:2889684-2889706 GGGCAAGGCTGCAGAGAAGAAGG - Intergenic
1020267656 7:6572045-6572067 GGGAGGAGAGTCAGGGAAGAGGG - Intergenic
1020748655 7:12111722-12111744 GCGCAGGGCGTCAGGGCAGAGGG + Intergenic
1022494353 7:30843833-30843855 GGGCAGAGGAGGAGGGAAGAAGG + Intronic
1023416224 7:39935508-39935530 TTGCAGAGGTTCAGGGAGGAAGG - Intergenic
1023751655 7:43378848-43378870 GGGCAGAGCAGCAGGAATGATGG + Intronic
1023751742 7:43379553-43379575 GGGCAGAGCAGCAGGAATGATGG - Intronic
1023789975 7:43746243-43746265 GGGGAGAGCTTCATGAAAGCAGG + Intergenic
1024442918 7:49442522-49442544 GGCCACAGCTTCAGAGAATATGG - Intergenic
1025025549 7:55513553-55513575 GGGCAGAGCTGCAGGGCATTTGG - Intronic
1026266240 7:68798291-68798313 GGGCTTCTCTTCAGGGAAGACGG + Intergenic
1026833536 7:73623937-73623959 GGTCTGCGCTTCGGGGAAGAGGG + Intronic
1026929905 7:74218037-74218059 GGGCAGGGCCTGAGGGGAGAGGG - Intronic
1027036914 7:74931767-74931789 GGCCAGAGCTTGGGGGAAGGGGG + Intergenic
1027086649 7:75269692-75269714 GGCCAGAGCTTGGGGGAAGGGGG - Intergenic
1027218177 7:76197585-76197607 GGGAGCAGCTTCAGGGGAGAAGG - Intergenic
1029392950 7:100287696-100287718 GGCCAGAGCTGGAGGGAAGGGGG - Intergenic
1029492960 7:100882251-100882273 GGGCAGAGGTCCAGGGAAGTAGG - Intronic
1029787454 7:102806873-102806895 GAGCTGAGCTTCTGGGGAGACGG + Intronic
1030775506 7:113529968-113529990 TGGCCGAGCCTCAGGGATGAAGG - Intergenic
1030775640 7:113530828-113530850 TGGCATGGCTTCAGGGAAGAAGG - Intergenic
1031123053 7:117742944-117742966 GGGCAGGGCTGCAGGGAGAATGG - Intronic
1032539680 7:132692813-132692835 AGGCAGAGGATCAGGGAGGATGG - Intronic
1032672896 7:134101223-134101245 GGGCAGAAGGTCAGAGAAGAGGG + Intergenic
1033541304 7:142358394-142358416 GGTGAGAGCTGCAGGGAAGATGG - Intergenic
1033663500 7:143420066-143420088 GGCCAGACCTTCAGGGAGGACGG - Intergenic
1033917650 7:146347273-146347295 AGGCAGAGATTGAGGCAAGAAGG + Intronic
1034563204 7:151894724-151894746 GGGCAGAGGAGCAGGGAGGATGG - Intergenic
1034693223 7:153030725-153030747 GGAGAAAGCTTCATGGAAGATGG - Intergenic
1035331033 7:158097607-158097629 GGGCAGTGCTCCTGGGAAAAAGG - Intronic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1037454025 8:19045958-19045980 GGGCAGAGGATAAGGGATGATGG - Intronic
1038718387 8:30011942-30011964 GCCCAGAGCTGAAGGGAAGAGGG + Intergenic
1039400782 8:37267147-37267169 TGGGACAGCTTCAGGTAAGATGG + Intergenic
1039439193 8:37583234-37583256 GGGCAGAGTTTCAGTGACGTAGG - Intergenic
1039469630 8:37805192-37805214 GGGCAGAGCTCCAGGATGGAGGG - Intronic
1039892993 8:41697086-41697108 GGGCAGAGCTGGAGAGAAGGGGG - Intronic
1040915546 8:52564314-52564336 GGGCAGCGCTGGAGGGAGGAGGG - Intronic
1041196923 8:55410133-55410155 GGAGAGGGCTTCAGGAAAGAGGG - Intronic
1042549380 8:69980728-69980750 GTGCAGAGATACAGGAAAGATGG + Intergenic
1043021061 8:75000314-75000336 GGGCAGCTCTTGAAGGAAGATGG + Intronic
1043174034 8:77000840-77000862 AGGCAGAGCTTCTGGGAATGGGG + Intronic
1045640785 8:104248045-104248067 AGACAGTGCTTCAAGGAAGAGGG + Intronic
1045653646 8:104365812-104365834 GACCAGAGCTTCAGGGCAAAAGG - Intronic
1045726327 8:105178037-105178059 GCGCAAAGCCTGAGGGAAGAGGG + Intronic
1046250081 8:111619341-111619363 GTCCAGAGCTTTATGGAAGATGG + Intergenic
1046770222 8:118110858-118110880 GCGCAGAGCGTCCGGGAAGCGGG + Exonic
1047526555 8:125638813-125638835 AGGCAGGGCTTCAGGGAGGAGGG + Intergenic
1047720508 8:127634770-127634792 GGGCAGAGCTTGAGTGATGATGG - Intergenic
1047778416 8:128092314-128092336 GGGAAGAGCTTCAGGGAGCTGGG - Intergenic
1047932477 8:129744050-129744072 GGGCAGAGTTCTAGGAAAGAGGG - Intergenic
1047933005 8:129749413-129749435 GGCCAGAAGTTCAGGGAAGAGGG - Intronic
1048299818 8:133243269-133243291 GGTCAGGGCTGCAGGGAACAGGG + Intronic
1048510234 8:135055386-135055408 GGGCAGAGTGTCAGAGCAGAAGG + Intergenic
1048591676 8:135826279-135826301 GGACAGGGCTGCAGGGAACAAGG + Intergenic
1049499862 8:142956017-142956039 GGGCAGGACTACAGGGGAGAGGG + Intergenic
1050406151 9:5310366-5310388 GGGGAGAGGTACAGGGAGGAAGG - Intergenic
1051052657 9:12950718-12950740 GGCCAGAGTTCCAGGGAAGCTGG - Intergenic
1051217450 9:14813861-14813883 TGGCTGAGCATTAGGGAAGAAGG - Intronic
1051356524 9:16244121-16244143 GCACAGAGCCCCAGGGAAGAAGG - Intronic
1051531352 9:18107496-18107518 TGGCAGTACTTCAGGGAATAAGG + Intergenic
1051558321 9:18410351-18410373 TGGGAGAGCATCAGGGGAGAGGG - Intergenic
1052294153 9:26879026-26879048 AGGAAGAGATTCAGGGAAGAAGG - Intronic
1054456895 9:65436331-65436353 GGGCAGAGGATCAGAGAGGAGGG + Intergenic
1055192422 9:73541550-73541572 GGACAAAGCTTCAGGCAGGAAGG - Intergenic
1055678538 9:78690977-78690999 GGGCAGAACTTCAGTGTAGCTGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058969113 9:110064007-110064029 TGGCAAGGCTTCAGAGAAGAGGG - Intronic
1059374637 9:113872705-113872727 GGGCAGAGCTTCAAGGGGGAGGG - Intergenic
1060024637 9:120160933-120160955 GTGCAGGGCTTCAGGGCACAGGG - Intergenic
1060243067 9:121921386-121921408 GAACAGAGCTTCAAGGAAGAGGG + Intronic
1060404804 9:123367933-123367955 GGGATGGTCTTCAGGGAAGACGG + Intronic
1061493087 9:130956992-130957014 CGGCAGAGCAGCAGGGAAGGGGG - Intergenic
1061728128 9:132592492-132592514 GAGGAGAACTTTAGGGAAGAGGG - Intergenic
1061887871 9:133601878-133601900 GGGAGGAGCCTCAGGGAGGAAGG + Intergenic
1062101281 9:134730036-134730058 GGGCAGAGCAAGTGGGAAGAAGG - Intronic
1062151092 9:135019432-135019454 CAGGAGAGCTCCAGGGAAGACGG + Intergenic
1185859991 X:3568985-3569007 GGGAGGAGCCTCAGGGAAGCTGG - Intergenic
1188074928 X:25763680-25763702 GGGGAGAGCTTGAGGGAAAATGG + Intergenic
1189104126 X:38219870-38219892 GCGAAGAGCTTCAGGGGAGTAGG - Intronic
1189178193 X:38979111-38979133 GGGCAGAGCTACAGAGTAGTGGG - Intergenic
1189294847 X:39910849-39910871 GTGCAGAGCTGCAGGGAACAGGG + Intergenic
1190932816 X:54964004-54964026 GGGCAGAGTTTCAGTGATGTTGG - Intronic
1191132581 X:57030644-57030666 GGACAGAGCATCAGGGGGGATGG - Intergenic
1192125972 X:68501004-68501026 GGGGAAAGCTTCACAGAAGAGGG - Intronic
1192234243 X:69285880-69285902 GGGCAGAGGGGCAGGGAAGAGGG + Intergenic
1192292859 X:69815690-69815712 GGACAGAGCTTCTGGGCATAGGG + Intronic
1193712180 X:84893722-84893744 GGACAGAGCTCCCAGGAAGAGGG - Intergenic
1194500129 X:94672390-94672412 GGGGAGAGCATTAGGGAACAGGG + Intergenic
1195327753 X:103771726-103771748 GGGCTGAGATGCAGAGAAGAAGG + Intergenic
1198939790 X:141941020-141941042 TGGTAGCTCTTCAGGGAAGAGGG + Intergenic
1199105348 X:143859702-143859724 GGACAGTGCTCCATGGAAGATGG - Intergenic
1199264710 X:145817526-145817548 GGGCAGAGTTCCAGGCAAGAGGG + Intergenic
1199464148 X:148116815-148116837 TGGCAGAGCCTCAGGGATGAAGG - Intergenic
1199563156 X:149185809-149185831 TGGCAGAACTCCAGGGAAGGGGG + Intergenic
1199711123 X:150470433-150470455 GGGCAGAGCGACAGGGAGCATGG - Exonic
1199742145 X:150745618-150745640 GGGCAGAGCTGCTGGGGAGCCGG - Intronic
1199856266 X:151761502-151761524 GGACAGAGACTCAGGGAACATGG - Intergenic
1200071276 X:153530653-153530675 GGGCAGAGCTTCAGGCAGGTGGG + Intronic
1200079454 X:153568751-153568773 GGCCAGGGCTTCGTGGAAGAAGG - Intronic
1200714647 Y:6524365-6524387 GGGCAAGGCTGCAGGGAACAAGG - Intergenic
1200750690 Y:6941718-6941740 GAGCAGAGCTTATGGGAAGATGG + Intronic
1201019177 Y:9636765-9636787 GGGCAAGGCTGCAGGGAACAAGG + Intergenic
1201239191 Y:11941903-11941925 GGACAGAGTTTCAGTGAAGAAGG + Intergenic