ID: 923401956

View in Genome Browser
Species Human (GRCh38)
Location 1:233624312-233624334
Sequence ACTTGGGGCTACTGAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 328}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923401943_923401956 30 Left 923401943 1:233624259-233624281 CCTATCCCAGGAAAGTGTGCTCC 0: 1
1: 0
2: 2
3: 14
4: 161
Right 923401956 1:233624312-233624334 ACTTGGGGCTACTGAGAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 328
923401950_923401956 7 Left 923401950 1:233624282-233624304 CCAGGATGCGCTGAGCCAGGCAC 0: 1
1: 0
2: 2
3: 11
4: 154
Right 923401956 1:233624312-233624334 ACTTGGGGCTACTGAGAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 328
923401944_923401956 25 Left 923401944 1:233624264-233624286 CCCAGGAAAGTGTGCTCCCCAGG No data
Right 923401956 1:233624312-233624334 ACTTGGGGCTACTGAGAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 328
923401949_923401956 8 Left 923401949 1:233624281-233624303 CCCAGGATGCGCTGAGCCAGGCA 0: 1
1: 0
2: 2
3: 12
4: 181
Right 923401956 1:233624312-233624334 ACTTGGGGCTACTGAGAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 328
923401954_923401956 -8 Left 923401954 1:233624297-233624319 CCAGGCACACACAGGACTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 235
Right 923401956 1:233624312-233624334 ACTTGGGGCTACTGAGAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 328
923401948_923401956 9 Left 923401948 1:233624280-233624302 CCCCAGGATGCGCTGAGCCAGGC 0: 1
1: 0
2: 2
3: 18
4: 237
Right 923401956 1:233624312-233624334 ACTTGGGGCTACTGAGAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 328
923401946_923401956 24 Left 923401946 1:233624265-233624287 CCAGGAAAGTGTGCTCCCCAGGA 0: 1
1: 0
2: 1
3: 10
4: 191
Right 923401956 1:233624312-233624334 ACTTGGGGCTACTGAGAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923401956 Original CRISPR ACTTGGGGCTACTGAGAAGC AGG Intronic
900472795 1:2863049-2863071 ACTGAGGGCCACGGAGAAGCTGG - Intergenic
901344911 1:8531326-8531348 ACTTCAGACTACTGAGTAGCTGG - Intronic
901640436 1:10690433-10690455 GCATGGGGCTACTGAGAATCAGG + Intronic
902797749 1:18810359-18810381 GATTGGGGGTACTGAGAAGAGGG - Intergenic
903008760 1:20315806-20315828 ACTTGGCACAACAGAGAAGCTGG + Intronic
903090519 1:20911445-20911467 ACTTTAGCCTCCTGAGAAGCTGG - Intronic
904621462 1:31777758-31777780 ACTTGGAGCTGATTAGAAGCAGG + Intergenic
905104108 1:35552677-35552699 ACTTTGGCCTACTGAATAGCTGG - Intronic
906060721 1:42946756-42946778 TCTTGTGCCTACTGAGGAGCAGG - Intronic
906491040 1:46268878-46268900 ACTTTGGCCTCCTGAGTAGCTGG + Intronic
906693648 1:47809735-47809757 ACACTGGGCTACTGAGCAGCAGG + Intronic
907346600 1:53786809-53786831 ACCTCGGGCTCCTGAGTAGCTGG + Intronic
907641606 1:56196107-56196129 ACCTTGGCCTCCTGAGAAGCTGG - Intergenic
908754991 1:67461362-67461384 GCTTTGGGCTAATGGGAAGCGGG - Intergenic
910839371 1:91546746-91546768 ACTTGGGGCTTCTGAGAGAGAGG - Intergenic
912388040 1:109282387-109282409 ACTTGGGGCTGCTGGGCGGCTGG - Intronic
914758364 1:150579407-150579429 ACTTTTGGCTACGGAGAAGGAGG - Exonic
914823965 1:151127825-151127847 ACCTCAGCCTACTGAGAAGCTGG + Intergenic
914957417 1:152175395-152175417 AGTTGGGGCTACTTGGAATCAGG - Intergenic
916589750 1:166178789-166178811 ACTTGGAGATACGGAGAAGTGGG - Intergenic
916589846 1:166179828-166179850 ACCTGGGCCTTCTGAGTAGCTGG + Intergenic
917101466 1:171450169-171450191 ACTTGAGCCTCCTGAGCAGCTGG - Intergenic
917348620 1:174055073-174055095 ACTTCAGCCTCCTGAGAAGCTGG + Intergenic
917829895 1:178871096-178871118 ACTTGAGTCTACTGAGAAAGAGG - Intronic
919850115 1:201666808-201666830 ACTTGGGGTTTCTGGGAGGCAGG + Intronic
920851689 1:209632499-209632521 TCTTGGGGCTCCTGTAAAGCAGG - Intronic
921252668 1:213312138-213312160 ACTTTGGGAGACTGAGAAGGTGG - Intergenic
921299669 1:213738495-213738517 GCTTAGAGCTCCTGAGAAGCTGG + Intergenic
923401956 1:233624312-233624334 ACTTGGGGCTACTGAGAAGCAGG + Intronic
924222093 1:241888123-241888145 ACTTCAGCCTCCTGAGAAGCTGG - Intronic
924949452 1:248868540-248868562 ACTTCAGGCTCCTGAGTAGCGGG - Intergenic
1063687143 10:8247515-8247537 CCTGGGGGCCACTGAGAGGCTGG + Intergenic
1065917307 10:30364709-30364731 GCTTGGGGCTGCTGACAAGCAGG - Intronic
1066510961 10:36095429-36095451 ACTGGGGTCTATTGAGGAGCAGG + Intergenic
1067037535 10:42931397-42931419 TCTGGGGGCTCCTTAGAAGCAGG - Intergenic
1069259093 10:66371662-66371684 AGTTGGGGATGATGAGAAGCAGG - Intronic
1070241342 10:74684655-74684677 ACTTTGGCCTCCTGAGTAGCTGG - Intronic
1071759410 10:88583398-88583420 ACCTGGGGCTGCGGAGAACCGGG + Intronic
1072553931 10:96500201-96500223 ACCTTGGCCTACTGAGTAGCTGG - Intronic
1072924595 10:99605824-99605846 ACTCGGGGTTACAGAGAAGGAGG - Intergenic
1073009537 10:100348508-100348530 ACCTGGGGGTACTGAGATGCAGG + Intronic
1073427041 10:103461302-103461324 ACTTCAGGCTCCTGAGCAGCTGG + Intergenic
1074004873 10:109411313-109411335 AGGTGGGGCTAATGAGAAGCAGG - Intergenic
1076129081 10:127999933-127999955 CCTAGGGGCTACTGAGAACGCGG + Intronic
1076198571 10:128539983-128540005 GCTTGGCGCTACTGTGGAGCTGG - Intergenic
1076621867 10:131794132-131794154 AGTTGGGGCTGCTGAGCACCTGG + Intergenic
1078491689 11:11775329-11775351 ACTTGGGAATTCTGAGAAGTTGG + Intergenic
1079579425 11:22044406-22044428 ACTTGAGCCTCCTGAGTAGCTGG - Intergenic
1080479775 11:32634870-32634892 ACTTCAGGCTTCTGAGTAGCTGG - Intronic
1080666549 11:34341376-34341398 ACAGAGGGCTTCTGAGAAGCTGG + Intronic
1080770305 11:35334644-35334666 TCTTGGGGCTACTGATAATAAGG - Intronic
1080782451 11:35442724-35442746 ACCTTAGGCTACTGAGTAGCTGG + Intronic
1081811999 11:45919372-45919394 ACTTGGGGCTGCTGGGAGGAGGG - Intergenic
1082056013 11:47817088-47817110 ACCTAGGGCTCCTGAGTAGCTGG + Intronic
1085073509 11:73570617-73570639 ACTTGAGCCTCCTGAGTAGCTGG - Intronic
1085088954 11:73693171-73693193 GCTTGAGCCTACTGAGTAGCTGG - Intronic
1087293574 11:96344090-96344112 ACTTGAGCCTCCTGAGTAGCTGG + Intergenic
1087491523 11:98833601-98833623 TCTTGGGCCTCCTGAGTAGCTGG + Intergenic
1087514696 11:99142936-99142958 ACATGGGGCTGCTGAGCACCAGG - Intronic
1088867569 11:113863528-113863550 ACTTCAGCCTTCTGAGAAGCTGG - Intronic
1089643486 11:119863191-119863213 CCTTGGAGCAAATGAGAAGCAGG + Intergenic
1089658987 11:119973628-119973650 ACCTCAGGCTCCTGAGAAGCTGG - Intergenic
1091787258 12:3250667-3250689 ATCTGTGGCTGCTGAGAAGCTGG - Intronic
1093666102 12:21815066-21815088 ACTTGAGCCTTCTGAGTAGCTGG - Intronic
1093880172 12:24395266-24395288 ACTTAGGGCTACTGACAAAATGG - Intergenic
1094826983 12:34276938-34276960 ACTTCGGCCTCCTGAGTAGCTGG - Intergenic
1096586677 12:52627283-52627305 ACTTCTGGCTACTGGGAAGCAGG - Intergenic
1096672424 12:53208041-53208063 ACTTTGGCCTCCTGAGTAGCTGG + Intergenic
1096726268 12:53565605-53565627 ACTTCGGCCTCCTGAGTAGCTGG + Intronic
1097691090 12:62735324-62735346 ACTTCGGCCTCCTGAGTAGCTGG + Intronic
1098311436 12:69153002-69153024 ACTTCAGGCTCCTGAGTAGCTGG - Intergenic
1099495684 12:83343284-83343306 AAGTGGGGCTACTGAGATGCAGG - Intergenic
1099928014 12:89041350-89041372 ACATGGGCCTACTGGAAAGCAGG + Intergenic
1100219387 12:92487901-92487923 ACTTCGGCCTCCTGAGTAGCTGG + Intergenic
1101275038 12:103190074-103190096 AATTGGGGCAAAAGAGAAGCTGG + Intergenic
1102062488 12:109944055-109944077 ACTTCAGGCTTCTGAGTAGCTGG - Intronic
1106745801 13:32705297-32705319 TCTTGGGGCTACTGAAAATATGG + Intronic
1107319380 13:39169220-39169242 ACTAAGGGCTACTGAGGTGCTGG - Intergenic
1107932546 13:45318242-45318264 ACTTCGGCCTCCTGAGTAGCTGG - Intergenic
1110229819 13:73156190-73156212 ATTTGGGACTTTTGAGAAGCAGG + Intergenic
1111985937 13:95067055-95067077 ACATGGGGCAACTGGGAAACAGG + Intronic
1114238499 14:20843890-20843912 ACTTTGGCCTCTTGAGAAGCTGG - Intergenic
1114664517 14:24369852-24369874 TTTGGGGGCTACAGAGAAGCAGG + Exonic
1115548224 14:34482032-34482054 ACCTTGGGCTCCTGAGTAGCTGG - Intergenic
1115716749 14:36114002-36114024 TGTTGGGGCTAATGAGAAGAGGG - Intergenic
1115998081 14:39214109-39214131 ACTTCAGTCTGCTGAGAAGCTGG - Intergenic
1117579677 14:57139627-57139649 ACTTCAGCCTCCTGAGAAGCTGG + Intergenic
1117848581 14:59941261-59941283 AGATGGGGCAACTGAGAAGATGG + Intronic
1118662907 14:68034384-68034406 ACTTCAGGCTCCTGAGTAGCTGG + Intronic
1118748447 14:68790333-68790355 CCTTGAGGCTGCTGAGGAGCTGG + Exonic
1118994469 14:70823376-70823398 CTTTGGGACTACTGAGAACCAGG - Intergenic
1119337891 14:73849854-73849876 AATTGAGCCTACTGAGTAGCTGG - Intergenic
1119361179 14:74051302-74051324 TCTTGTGCCTACTGAGTAGCTGG - Intronic
1119505947 14:75173270-75173292 ACTTCAGGCTCCTGAGTAGCTGG - Intronic
1122516068 14:102309661-102309683 ACTTTAGGCTTCTGAGTAGCTGG - Intergenic
1122718285 14:103708057-103708079 ACTAGGGCCTGCTGAGATGCAGG + Intronic
1122721605 14:103725460-103725482 ATTTGGGGCTGCTGAGAAGCTGG + Intronic
1202833287 14_GL000009v2_random:59072-59094 ATTTGGGGCTGCAGAGCAGCTGG - Intergenic
1123416459 15:20099227-20099249 GCTTGGGCCTCCTGAGTAGCTGG + Intergenic
1123525797 15:21106332-21106354 GCTTGGGCCTCCTGAGTAGCTGG + Intergenic
1123579503 15:21703619-21703641 ACTTGGGTCCACTGAAGAGCAGG + Intergenic
1123616130 15:22146130-22146152 ACTTGGGTCCACTGAAGAGCAGG + Intergenic
1125194620 15:37031951-37031973 ACCTTGGCCTACTGAGTAGCAGG + Intronic
1129476355 15:75786657-75786679 ACTTGGGGCTGCCGATGAGCAGG + Intergenic
1129570730 15:76681618-76681640 GCATGGGGATACTGAGAACCAGG + Intronic
1129767794 15:78181264-78181286 ACTTTGGGACACTGAGATGCTGG + Intronic
1131891030 15:96971493-96971515 GCTTTGGCCTCCTGAGAAGCTGG + Intergenic
1202988373 15_KI270727v1_random:437864-437886 ACTTGGGTCCACTGAAGAGCAGG + Intergenic
1132636070 16:947336-947358 AGTTGGGGCTACGCAGAGGCAGG + Intronic
1132867942 16:2103104-2103126 GCTGGGGGCCACGGAGAAGCAGG - Intronic
1133516051 16:6510282-6510304 ACTTGAGGTGACTGAAAAGCCGG - Intronic
1133646393 16:7768721-7768743 ACTTTAGCCTCCTGAGAAGCTGG - Intergenic
1134054671 16:11162224-11162246 ACTGGGGGCTCCTGGGAAGTGGG + Intronic
1134223212 16:12371410-12371432 ACTTCAGGCTCCGGAGAAGCTGG + Intronic
1134523827 16:14930010-14930032 GCTGGGGGCCACGGAGAAGCAGG + Intronic
1134549076 16:15130925-15130947 GCTGGGGGCCACGGAGAAGCAGG - Intronic
1134711418 16:16328495-16328517 GCTGGGGGCCACGGAGAAGCAGG + Intergenic
1134719269 16:16371794-16371816 GCTGGGGGCCACGGAGAAGCAGG + Intergenic
1134948157 16:18340091-18340113 GCTGGGGGCCACGGAGAAGCAGG - Intergenic
1134955411 16:18380198-18380220 GCTGGGGGCCACGGAGAAGCAGG - Intergenic
1135056878 16:19239168-19239190 ACTTTGGCCTCCTGAGTAGCTGG - Intronic
1136687148 16:32002302-32002324 ACTAGGGGCTCCTGAGGAGAGGG - Intergenic
1136787761 16:32945853-32945875 ACTAGGGGCTCCTGAGGAGAGGG - Intergenic
1136882020 16:33907936-33907958 ACTAGGGGCTCCTGAGGAGAGGG + Intergenic
1137234253 16:46600893-46600915 ACCTCGGCCTCCTGAGAAGCTGG - Intronic
1137635092 16:49979252-49979274 ACCTCAGCCTACTGAGAAGCTGG + Intergenic
1137739506 16:50753907-50753929 ACTTAGGGCTAATTAGAGGCAGG + Intronic
1138600947 16:58053726-58053748 ACTTTGGCCTCCTGAGTAGCTGG - Intergenic
1139349405 16:66325843-66325865 ACTTAGGGATTCTGAGCAGCTGG + Intergenic
1139399802 16:66672288-66672310 GCTTCAGCCTACTGAGAAGCTGG - Intronic
1139796862 16:69490041-69490063 ACTTCGGCCTCCTGAGTAGCTGG - Intergenic
1203089989 16_KI270728v1_random:1207510-1207532 ACTAGGGGCTCCTGAGGAGAGGG - Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144168344 17:12634167-12634189 ACTTTGGCCTCCTGAGTAGCTGG - Intergenic
1146720351 17:35119541-35119563 TCCTGTGGCTCCTGAGAAGCTGG + Exonic
1146849464 17:36209786-36209808 ACCTGAGCCTACTGAGCAGCTGG + Intronic
1147148120 17:38497971-38497993 ACTAGGGGCTCCTGAGGAGAGGG - Intronic
1148061228 17:44837945-44837967 GCTTCGGGCTCCTGAGTAGCTGG + Intergenic
1148635044 17:49142575-49142597 ACTTCAGCCTACTGAGTAGCTGG - Intronic
1148887713 17:50785794-50785816 ACTGAGGGTTATTGAGAAGCTGG - Intergenic
1149123309 17:53196457-53196479 GCATGGGGCTACTGTGCAGCAGG + Intergenic
1151488349 17:74416538-74416560 ACTTTGGGAGACTGAGAGGCAGG + Intergenic
1151999837 17:77638294-77638316 ATTTGGGGCTACGGGGATGCAGG + Intergenic
1156014523 18:32533131-32533153 ACTTGGGGCTAGTGATATACTGG + Intergenic
1159037660 18:63293136-63293158 TCTTGGGGCCACTGAGAACCTGG - Intronic
1160217343 18:76944093-76944115 ACTTGGGCCTGCTGAGACCCAGG - Intronic
1160308217 18:77761105-77761127 GCATGGGGCTAAGGAGAAGCAGG - Intergenic
1160924617 19:1537671-1537693 ACCTGGGCCTCCTGAGTAGCTGG - Intergenic
1162272171 19:9625167-9625189 ACTTCGGCCTCCTGAGTAGCTGG - Intronic
1162410266 19:10501658-10501680 ACTTCGGCCTCCTGAGTAGCTGG + Intronic
1163039761 19:14593545-14593567 ACCTCGGCCTCCTGAGAAGCTGG - Intronic
1163165719 19:15496366-15496388 TCTTGAGGCTCCTGAGTAGCTGG - Intronic
1164686178 19:30168228-30168250 AGCTGGGGCTGCCGAGAAGCTGG - Intergenic
1165114510 19:33521147-33521169 GCACCGGGCTACTGAGAAGCAGG + Intronic
1165736021 19:38176122-38176144 ACTTGAGCCTCCTGAGTAGCTGG + Intronic
1166388197 19:42393905-42393927 ACTTGAGCCTCCTGAGTAGCTGG + Intergenic
1166393867 19:42424839-42424861 TCCTGGGGCTCCTGTGAAGCAGG + Intronic
1167058761 19:47130427-47130449 ACATGGGGCTACAGAGTAACAGG - Intronic
1167263492 19:48471939-48471961 ACTTCGGCCTCCTCAGAAGCTGG - Intronic
1168021376 19:53611345-53611367 ACTTGAGCCTCCTGAGTAGCTGG + Intergenic
1168048044 19:53808170-53808192 ACCTCAGCCTACTGAGAAGCTGG + Intronic
1168124501 19:54276085-54276107 AGATGGGGCTACTGAGATGCAGG + Intronic
1168177487 19:54635453-54635475 AGATGGGGCCACTGAGATGCAGG - Intronic
1168449322 19:56451752-56451774 ACCTTGGCCTACTGAGTAGCTGG - Intronic
1202639382 1_KI270706v1_random:68624-68646 ATTTGGGGCTGCAGAGCAGCTGG + Intergenic
925908148 2:8551867-8551889 ACATGGGGCTGCATAGAAGCAGG - Intergenic
926695396 2:15767063-15767085 ACTTGGGGAAACTGAGACTCGGG - Intergenic
929493282 2:42416701-42416723 ACTTTGGCCTCCTGAGTAGCTGG - Intronic
929858586 2:45655719-45655741 ACTTTGGCCTCCTGAGTAGCTGG - Intronic
930116967 2:47726347-47726369 GCTTTGGCCTACTGAGTAGCTGG + Intronic
931310524 2:61075370-61075392 ACTTGAGCCTCCTGAGTAGCTGG + Intronic
934063816 2:88321133-88321155 ACTTCAGGCTCCTGAGTAGCTGG - Intergenic
934968352 2:98742871-98742893 ACTTGGGGCTGCTGAGAGGATGG + Intergenic
936037235 2:109122754-109122776 ACTTCAGCCTACTGAGTAGCTGG - Intergenic
936741274 2:115512213-115512235 ACCTGAGCCTCCTGAGAAGCTGG + Intronic
936847003 2:116848407-116848429 ACTTGGGGCTATTGTGAATAGGG - Intergenic
937443535 2:121937078-121937100 ACTTGTGGCTACTGAGCACTTGG + Intergenic
940009611 2:149039343-149039365 ACCTGGGGCTTCTCAAAAGCCGG + Intronic
942081334 2:172402187-172402209 ACCTGGGGGTTCTCAGAAGCAGG - Intergenic
942105172 2:172626677-172626699 ACCTCAGCCTACTGAGAAGCTGG - Intergenic
943618694 2:190122922-190122944 ACTTTGGCCTCCTGAGTAGCTGG + Intronic
943669967 2:190649439-190649461 ACTTGGGGCGGCTGAGTCGCGGG + Intronic
944782099 2:203029575-203029597 ACTTCGGCCTCCTGAGTAGCTGG - Intronic
944894910 2:204153873-204153895 ACATGTGGCTACTGAGCACCAGG + Intergenic
946018071 2:216620166-216620188 TCCTGAGGCCACTGAGAAGCAGG - Intergenic
947982632 2:234423523-234423545 ACTTCGGCCTTCTGAGTAGCTGG - Intergenic
948347811 2:237313748-237313770 ACCTGGGGAGACTGAGTAGCAGG - Intergenic
948926723 2:241103508-241103530 ACTTCAGGCTCCTGAGTAGCTGG - Intergenic
1169153735 20:3311498-3311520 ACTTCAGCCTCCTGAGAAGCTGG + Intronic
1169237293 20:3941141-3941163 ACTTAAGGCTCCTGAGTAGCTGG + Intronic
1169323086 20:4651394-4651416 ACATGAGGCTCCTGAGAAGGTGG - Intergenic
1169521850 20:6382445-6382467 TTTTGGGGCCACTGAGAAGCAGG + Intergenic
1169817727 20:9675590-9675612 ACTTCAGCCTCCTGAGAAGCTGG + Intronic
1169909771 20:10637779-10637801 ACCTGGGGCTGCTGTGAAGCTGG - Exonic
1169918290 20:10705811-10705833 ACTAGGAGCTACAAAGAAGCTGG + Intergenic
1170206096 20:13800112-13800134 ACTTTGGACTTCTGAGAAGATGG + Intronic
1170336747 20:15278473-15278495 ACTCAGGGCTAGTGAAAAGCAGG - Intronic
1170376964 20:15710807-15710829 ACTGGAGGCTACTTAGAAACCGG - Intronic
1171983248 20:31641813-31641835 ACTTTGGCCTCCTGAGTAGCTGG + Intronic
1172054067 20:32141953-32141975 ACTTGGGGCCACAGAAAAGGTGG + Intronic
1172217976 20:33249963-33249985 GCTTGGTGCTTCTGGGAAGCTGG + Intergenic
1173496875 20:43525833-43525855 AATTGGGGGTACAGAGATGCCGG - Intronic
1173512346 20:43640047-43640069 ACCTGGGCCTCCTGAGTAGCTGG - Intronic
1173693199 20:44982229-44982251 ACTTCAGGCTCCTGAGTAGCTGG + Intronic
1174199897 20:48799832-48799854 ACTGGTGGCCACTGATAAGCAGG - Intronic
1174807719 20:53618876-53618898 ACTTTGGGCGACTGAGGAGGTGG + Intergenic
1175920245 20:62447191-62447213 ACTTGGGGCCACTGAGCCGGAGG - Intergenic
1176285465 21:5016807-5016829 ACCTGGGACAACTGAGAGGCAGG + Intergenic
1176647712 21:9366233-9366255 ATTTGGGGCTGCAGAGCAGCTGG + Intergenic
1177242349 21:18475475-18475497 ACCTCGGACTACTGAGTAGCTGG - Intronic
1179607627 21:42527441-42527463 ACTTAGGGCTTCTGAGGAGGCGG + Intronic
1179871716 21:44246668-44246690 ACCTGGGACAACTGAGAGGCAGG - Intronic
1179992519 21:44955632-44955654 ACTTTGGCCTCCTGAGCAGCTGG + Intronic
1180362561 22:11913240-11913262 ATTTGGGGCTGCAGAGCAGCTGG - Intergenic
1180860926 22:19082161-19082183 ACCTTAGCCTACTGAGAAGCTGG + Intronic
1180948250 22:19708540-19708562 ACCTGGGGCAAATGAGGAGCAGG + Intergenic
1181153374 22:20901240-20901262 ACCTGGGGCTCCTGAGTAGCTGG - Intergenic
1182235023 22:28868228-28868250 ACTTCAGCCTCCTGAGAAGCTGG - Intergenic
1183429319 22:37756129-37756151 ACTTGGAGCTGCTGGGCAGCGGG + Intronic
1183821660 22:40351107-40351129 ACCTCGGGCTCCTGAGTAGCTGG + Intronic
1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG + Intergenic
1184919381 22:47594911-47594933 ACTTGGGGATGCTGGGAAGAAGG - Intergenic
1185297188 22:50060234-50060256 AGTTGGGGCGACTGTGAAACTGG - Exonic
949114975 3:309622-309644 ACCTTGGCCTCCTGAGAAGCTGG + Intronic
950110408 3:10414979-10415001 ACATGGGGCCTCTGAGAAGGTGG + Intronic
951171564 3:19547945-19547967 ACTTGGGTCTGCTCAGAAGTAGG + Intergenic
951796690 3:26546752-26546774 GCTTTGGCCTACTGAGTAGCTGG - Intergenic
952288182 3:31988352-31988374 ACTGGGGGCCACTGAGGAGTAGG + Intronic
952953135 3:38540194-38540216 ACCTGAGGCTCCTGAGTAGCTGG - Intronic
953058719 3:39408969-39408991 ACTTTGGCCTCCTGAGTAGCTGG - Intronic
954485685 3:50849147-50849169 ACTTTAGGCTTCTGAGAAGCTGG + Intronic
955162888 3:56482312-56482334 ACTTTGGCCTCCTGAGTAGCTGG - Intergenic
958044101 3:88262708-88262730 ACTTCAGCCTCCTGAGAAGCTGG - Intergenic
959421489 3:106135170-106135192 ACTTGGGGCTAATGTGCACCAGG + Intergenic
960230737 3:115223619-115223641 ACTTCAGCCTACTGAGTAGCTGG + Intergenic
962535433 3:136325271-136325293 ACTTTGGCCTCCTGAGTAGCTGG + Intronic
962662676 3:137619983-137620005 ACTAGGGGCTAGTAAGATGCAGG + Intergenic
963912277 3:150825064-150825086 ACTTTGGGAGGCTGAGAAGCAGG + Intergenic
964385604 3:156144630-156144652 ACGTGGGGGGACAGAGAAGCAGG - Intronic
966346531 3:178987113-178987135 ACTTGGGGCTTCTGAGGTGGTGG + Intergenic
968187749 3:196644836-196644858 ACCTAGGGCTACCGAGTAGCTGG - Intronic
1202739169 3_GL000221v1_random:38754-38776 ATTTGGGGCTGCAGAGCAGCTGG - Intergenic
968641964 4:1719434-1719456 ACTTCGGCCTCCTGAGTAGCTGG - Intronic
968884358 4:3319557-3319579 AGCTGGGACTACTGAGTAGCTGG + Intronic
969270558 4:6097114-6097136 ACCTGGGCCTCCTGAGTAGCTGG + Intronic
970171636 4:13296495-13296517 ACCTCGGCCTACTGAGTAGCTGG + Intergenic
971183609 4:24352805-24352827 ACTAGAGGCTCCTTAGAAGCAGG + Intergenic
972202889 4:36736646-36736668 ACTTCGGCCTCCTGAGTAGCTGG - Intergenic
973686517 4:53376122-53376144 ACCTGGGACTACAGACAAGCAGG - Intergenic
974445808 4:61979815-61979837 TATTGGCGCTACTGAAAAGCTGG - Intronic
975478287 4:74848012-74848034 AATAGGGGCTTCTGAGAAGATGG - Intergenic
975852650 4:78588276-78588298 ACTTGAGCCTCCTGAGGAGCTGG - Intronic
978445365 4:108775356-108775378 ACTTCAGCCTACTGAGTAGCTGG + Intergenic
978503712 4:109434308-109434330 AGTAGGGGCGACTGAAAAGCTGG + Intronic
979962244 4:127034955-127034977 ACCTAGGCCTCCTGAGAAGCTGG + Intergenic
980686945 4:136240911-136240933 GCTGGTGGCTACAGAGAAGCTGG + Intergenic
982673384 4:158348632-158348654 CCTTGGGGCAAGTGAGAAGTGGG - Intronic
983052343 4:163063009-163063031 AATATGGGCTACTGAGAAGACGG + Intergenic
983769525 4:171532030-171532052 ACTTCAGCCTACTGAGTAGCCGG - Intergenic
1202766741 4_GL000008v2_random:154493-154515 ATTTGGGGCTGCAGAGCAGCTGG + Intergenic
988598874 5:32621002-32621024 ACCTGGGGGTACTGAGGAGGTGG + Intergenic
990233302 5:53739122-53739144 ACTTGGGGCTATTGGCAGGCAGG + Intergenic
992429291 5:76692264-76692286 ACTTAGGCCTCCTGAGCAGCTGG + Intronic
992792299 5:80224360-80224382 ACTTCAGCCTCCTGAGAAGCTGG - Intronic
992805754 5:80336049-80336071 ACTTCAGCCTTCTGAGAAGCTGG + Intergenic
993327388 5:86558768-86558790 ACTTTGGCCTCCTGAGTAGCTGG + Intergenic
994377412 5:99030737-99030759 ACTTCAGCCTTCTGAGAAGCTGG + Intergenic
994577730 5:101601395-101601417 ACTTCAGCCTACTGAGTAGCTGG + Intergenic
995585540 5:113644322-113644344 ACTTCGGCCTCCTGAGTAGCTGG + Intergenic
995752065 5:115462460-115462482 ACTTGGGGCTACAGAGATAGGGG + Intergenic
996035553 5:118754532-118754554 ACTTCAGCCTCCTGAGAAGCTGG - Intergenic
998036871 5:138924833-138924855 ACATCGGGCTCCTGAGAAGCTGG + Intronic
999783566 5:154870854-154870876 ACTTTGGGCTACACTGAAGCAGG + Intronic
999929017 5:156410371-156410393 ACTGGGGGCTACTGGGGAGGGGG + Intronic
1000212071 5:159116554-159116576 GCCTCGGGCTACTGAGTAGCTGG + Intergenic
1000871053 5:166578308-166578330 ACTTGAGGAAACTGAGAAGAAGG + Intergenic
1001009774 5:168086980-168087002 ACTGGGGGCCAGTGAGAAGCTGG - Intronic
1001196262 5:169676093-169676115 AATGGGGGCTCCTGAGAAGAAGG + Intronic
1003854458 6:10258985-10259007 TCTTGTGCCTACTGAGTAGCTGG + Intergenic
1004179179 6:13365955-13365977 ACTTCGGCCTCCTGAGTAGCTGG - Intronic
1005968252 6:30742481-30742503 GCCTGGGGCTGCCGAGAAGCAGG - Intronic
1006559859 6:34901623-34901645 ACCTGAGTCTACTGAGTAGCTGG + Intronic
1007627884 6:43256622-43256644 ACTTTAGCCTACTGAGTAGCTGG - Intronic
1008947522 6:57115143-57115165 ACTTCGGCCTCCTGAGTAGCTGG - Intronic
1009490863 6:64289060-64289082 GCTTGGAGCTGCTGAGAATCAGG - Intronic
1011572412 6:88753386-88753408 CCTTTGGGCTCCTGAGTAGCTGG - Intronic
1011620627 6:89239161-89239183 ACTTCGGCCTCCTGAGTAGCTGG + Intergenic
1013522374 6:110945084-110945106 ACTTCAGCCTACTGAGTAGCTGG + Intergenic
1014079655 6:117271403-117271425 ACTTGGGGCTACTGAGCACTTGG + Intronic
1015761631 6:136668267-136668289 ACTTTGGCCTCCTAAGAAGCTGG - Intronic
1017849250 6:158289693-158289715 ACTTCAGCCTTCTGAGAAGCTGG + Intronic
1018463467 6:164020893-164020915 ACTTGGTGCCTCTGAGGAGCAGG - Intergenic
1019504847 7:1385658-1385680 AGTTGGGGGTTCTGAGAGGCTGG - Intergenic
1021899195 7:25266316-25266338 ACCTGCTGCTAATGAGAAGCAGG + Intergenic
1022230287 7:28407427-28407449 AGTTGAGGCAACTGAGAACCAGG + Intronic
1023074762 7:36471987-36472009 GCTTGAGCCTCCTGAGAAGCTGG + Intergenic
1023476084 7:40579386-40579408 ACTTGGGGCCATTGAAAAGCTGG + Intronic
1024578439 7:50782829-50782851 ACTGGGCGCTCCTGAGGAGCGGG + Intronic
1025109582 7:56202853-56202875 ACCTTGGGCTTCTGAGTAGCTGG + Intergenic
1025132242 7:56381690-56381712 ACTTGAGCCTCCTGAGTAGCTGG - Intergenic
1025633085 7:63295397-63295419 ACCTTGGCCTACTGAGCAGCTGG - Intergenic
1025797837 7:64756488-64756510 ATTTGAGGCTACTAAGAACCTGG + Intergenic
1026150737 7:67786172-67786194 TCATGGGGCAACTGAGAAGAAGG - Intergenic
1026841115 7:73670340-73670362 ATCTGGGGCTACAGAGGAGCTGG + Intronic
1027432469 7:78128718-78128740 ACTTGGGGCTCCTTAGAAGGGGG + Intronic
1029465557 7:100722591-100722613 GCTTGGGGCTGCTGAGGGGCAGG + Intronic
1031605650 7:123764095-123764117 ACCTCAGGCTACTGAGTAGCTGG + Intergenic
1032387223 7:131533276-131533298 ACTTGGGGCCTCTGGGTAGCAGG + Intronic
1032816085 7:135475794-135475816 ACTTCAGACTCCTGAGAAGCTGG - Intronic
1033341965 7:140499154-140499176 ACTTGAGCCTCCTGAGTAGCTGG + Intergenic
1034205580 7:149311775-149311797 ACTTCAGGCTTCTGAGTAGCTGG + Intergenic
1034864124 7:154626031-154626053 ACTGGCGGCCACTGAGAAACAGG - Intronic
1035089893 7:156300221-156300243 ACTTCGGCCTCCTGAGTAGCTGG - Intergenic
1035541200 8:439743-439765 TCCTTGGGATACTGAGAAGCAGG - Intronic
1035747050 8:1969826-1969848 ACTTCGGCCTCCTGAGTAGCTGG + Intergenic
1035863830 8:3059756-3059778 ACTTGGACCCACTGAGTAGCTGG + Intronic
1037333128 8:17764252-17764274 CCTTGGGGATACAGAGAATCAGG + Intronic
1037863107 8:22420335-22420357 ACTTGTTCCTACTGAGATGCTGG + Exonic
1038758862 8:30367708-30367730 ACTTCGGCCTCCTGAGTAGCTGG - Intergenic
1040900918 8:52416150-52416172 ACTTGGGGAAACTGAGACACAGG + Intronic
1041404511 8:57483365-57483387 ACATGGGGCTACTGTGCACCTGG + Intergenic
1043057410 8:75456853-75456875 ACTTCAGGCTCCTGAGTAGCTGG + Intronic
1043625826 8:82256739-82256761 ACTTCAGCCTCCTGAGAAGCTGG - Intergenic
1045895426 8:107210218-107210240 ATTTGGGAGTACTGAGAAGGAGG + Intergenic
1046317719 8:112529004-112529026 ACTTGGGACATCTGAGCAGCAGG - Intronic
1046477057 8:114759213-114759235 ACTTGGGCCTCCTAAGTAGCGGG + Intergenic
1047730254 8:127721987-127722009 ACTTCTGGCTTCTGAGAATCTGG - Intergenic
1047969047 8:130069348-130069370 ACTTCGGCCTCCTGAGTAGCTGG + Intronic
1049282479 8:141757140-141757162 CCATGGTGCTGCTGAGAAGCTGG - Intergenic
1051241269 9:15058862-15058884 ACTTCAGGCTCCTGAGTAGCTGG - Intergenic
1053012062 9:34639460-34639482 ACTTCGGCCTCCTGAGTAGCTGG - Intronic
1054784688 9:69199643-69199665 GTTTGGAGCTACTGAGAACCTGG + Intronic
1055466003 9:76567142-76567164 ACTTCGGCCTCCTGAGGAGCTGG + Intergenic
1056880044 9:90382514-90382536 ACTTGAGCCTCCTGAGTAGCTGG - Intergenic
1057632790 9:96734439-96734461 ACCTCGGGCTCCTGAGTAGCTGG + Intergenic
1057850037 9:98558347-98558369 GATGGGGGCTACTGAGAAGTGGG + Intronic
1058910345 9:109515135-109515157 ACTTCAGCCTACTGAGTAGCTGG + Intergenic
1059296784 9:113277753-113277775 ACTTTGGGAGGCTGAGAAGCGGG + Intronic
1060913019 9:127365777-127365799 TCTTGTGGCTACTAAGCAGCAGG + Intronic
1203707900 Un_KI270742v1:69198-69220 ATTTGGGGCTGCAGAGCAGCTGG - Intergenic
1203547494 Un_KI270743v1:139372-139394 ATTTGGGGCTGCAGAGCAGCTGG + Intergenic
1186109103 X:6237216-6237238 ACTTAGGGAGACTGAGAAGCAGG - Intergenic
1187878762 X:23826877-23826899 ACTTCTGCCTTCTGAGAAGCTGG + Intergenic
1190047317 X:47123048-47123070 ACTTCAGCCTCCTGAGAAGCTGG - Intergenic
1195741358 X:108067949-108067971 ATTTGGGGCTACCTAGAAGTGGG - Intronic
1196826593 X:119745496-119745518 ACTTGAGCCTTCTGAGTAGCTGG + Intergenic
1201164782 Y:11199068-11199090 ACTTGAGCCCACTGAGTAGCTGG - Intergenic
1201774740 Y:17650131-17650153 ACTTTGGCCTCCTGAGTAGCTGG - Intergenic
1201826816 Y:18255858-18255880 ACTTTGGCCTCCTGAGTAGCTGG + Intergenic