ID: 923404495

View in Genome Browser
Species Human (GRCh38)
Location 1:233646593-233646615
Sequence CTGCTCTCACTCCCTGCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 331}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923404495_923404507 24 Left 923404495 1:233646593-233646615 CCGAGTGCAGGGAGTGAGAGCAG 0: 1
1: 0
2: 2
3: 40
4: 331
Right 923404507 1:233646640-233646662 TGGAGGGTTCTAATGTGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 111
923404495_923404506 23 Left 923404495 1:233646593-233646615 CCGAGTGCAGGGAGTGAGAGCAG 0: 1
1: 0
2: 2
3: 40
4: 331
Right 923404506 1:233646639-233646661 CTGGAGGGTTCTAATGTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 94
923404495_923404505 22 Left 923404495 1:233646593-233646615 CCGAGTGCAGGGAGTGAGAGCAG 0: 1
1: 0
2: 2
3: 40
4: 331
Right 923404505 1:233646638-233646660 CCTGGAGGGTTCTAATGTGGTGG No data
923404495_923404503 19 Left 923404495 1:233646593-233646615 CCGAGTGCAGGGAGTGAGAGCAG 0: 1
1: 0
2: 2
3: 40
4: 331
Right 923404503 1:233646635-233646657 AGTCCTGGAGGGTTCTAATGTGG 0: 1
1: 0
2: 0
3: 11
4: 129
923404495_923404500 7 Left 923404495 1:233646593-233646615 CCGAGTGCAGGGAGTGAGAGCAG 0: 1
1: 0
2: 2
3: 40
4: 331
Right 923404500 1:233646623-233646645 GTCTGAAGGCCGAGTCCTGGAGG 0: 1
1: 0
2: 1
3: 17
4: 166
923404495_923404498 -7 Left 923404495 1:233646593-233646615 CCGAGTGCAGGGAGTGAGAGCAG 0: 1
1: 0
2: 2
3: 40
4: 331
Right 923404498 1:233646609-233646631 AGAGCAGATGGAAGGTCTGAAGG 0: 1
1: 1
2: 4
3: 36
4: 361
923404495_923404501 8 Left 923404495 1:233646593-233646615 CCGAGTGCAGGGAGTGAGAGCAG 0: 1
1: 0
2: 2
3: 40
4: 331
Right 923404501 1:233646624-233646646 TCTGAAGGCCGAGTCCTGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 144
923404495_923404499 4 Left 923404495 1:233646593-233646615 CCGAGTGCAGGGAGTGAGAGCAG 0: 1
1: 0
2: 2
3: 40
4: 331
Right 923404499 1:233646620-233646642 AAGGTCTGAAGGCCGAGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923404495 Original CRISPR CTGCTCTCACTCCCTGCACT CGG (reversed) Intronic
900467418 1:2832654-2832676 CTCCTCCCACTGGCTGCACTGGG - Intergenic
900531728 1:3157108-3157130 GTGCTAACACTCCCTGCCCTGGG - Intronic
901639825 1:10687558-10687580 CTGGCCTCACTCCCTGCCCTGGG + Intronic
901661330 1:10799658-10799680 CTGACTTCAGTCCCTGCACTGGG - Intergenic
902134413 1:14292527-14292549 CTGCCTTCACTCCCTGGACATGG - Intergenic
902992739 1:20200627-20200649 CCTCTCTGCCTCCCTGCACTGGG - Intergenic
903589165 1:24441172-24441194 CTGCTCTCCCTCCCTGGAGCAGG + Intronic
903594597 1:24484466-24484488 CAGCTCTCTTTCCCTCCACTAGG + Intergenic
904609511 1:31717409-31717431 CTGCTGGCCCTCCCTGCACATGG - Intergenic
905243702 1:36597626-36597648 CTTCTCTCACTTCCTGCCCCAGG + Intergenic
905910163 1:41647994-41648016 CTGCTCAGTCTCCCTGCACCAGG + Intronic
906345026 1:45009715-45009737 TTACCCTCCCTCCCTGCACTGGG + Intronic
906740804 1:48181973-48181995 CTGCACTCACTTCCTGCTGTTGG + Intergenic
907419615 1:54338126-54338148 CTGCACTCACTGCCTGCTCCAGG + Intronic
910296810 1:85655273-85655295 CTCCTCTCTCTCCCTGCAAAAGG + Intronic
910696532 1:90024324-90024346 CTGCCTTCACTCCCTGCTCTGGG + Intronic
912777606 1:112515653-112515675 TTGCTCTCCCTCCCTGCTCTTGG - Intronic
915270187 1:154748158-154748180 CTCATCTCACTCCCTGCTGTGGG + Intronic
915626275 1:157115806-157115828 GTGATCTCACTCCCTACACCAGG + Intergenic
915696610 1:157748993-157749015 CTGTTCTCACTCACTGCCCTGGG - Intronic
917073719 1:171181245-171181267 CTCCCCTCACTCCCAGCCCTTGG - Intergenic
917476652 1:175374711-175374733 CTGCTGCCTCTCCCTGCACCAGG - Intronic
917730709 1:177871986-177872008 CTTCTCTCACACCCTCCCCTGGG + Intergenic
917759004 1:178134825-178134847 CTGCTCTCACTTCCAACTCTTGG - Intronic
918181136 1:182086704-182086726 CGGCTCTCTTCCCCTGCACTAGG - Intergenic
918742236 1:188147150-188147172 CTGCCCTCATTCCTTGCTCTTGG + Intergenic
919533936 1:198762605-198762627 CTGTTCTCTCTCCCTCCAGTAGG - Intergenic
919803852 1:201369262-201369284 CTGGTCTCACTCCCTTGCCTTGG + Intronic
920089479 1:203441980-203442002 CTGCTCACTTTCCCTGCCCTCGG - Intergenic
920256678 1:204660115-204660137 CTGCTGTCACCCCCTGGACCAGG - Intronic
920967744 1:210715272-210715294 CTCCTGTCACTCCCTGCAAGAGG + Intronic
921335702 1:214083677-214083699 CTACTCTCTCTCCCTTCCCTTGG - Intergenic
921339152 1:214117232-214117254 CCTCTTTCACTCTCTGCACTCGG - Intergenic
922608798 1:226908951-226908973 CCTCTCTCTCCCCCTGCACTTGG - Intronic
923346018 1:233053306-233053328 CAGGTATCAGTCCCTGCACTGGG + Intronic
923404495 1:233646593-233646615 CTGCTCTCACTCCCTGCACTCGG - Intronic
923829928 1:237543581-237543603 CAGCTAACACTCCCTGAACTTGG + Intronic
924716779 1:246582618-246582640 CTGGTCTCAATTCCTGTACTGGG + Intronic
1064097298 10:12433347-12433369 CTGCTCTCATTTCCTGCTCCAGG + Intronic
1064379802 10:14831181-14831203 CTGCTCTCACTCTCCTAACTTGG + Intronic
1065479421 10:26177497-26177519 CTGCTCCCACACCCTGCAGGTGG + Intronic
1066188413 10:33033069-33033091 CTGCTCTCAAAGCCTCCACTGGG + Intergenic
1066700745 10:38125490-38125512 CTCCTCTCCCTCCATGCAGTAGG - Exonic
1067786600 10:49254897-49254919 CTCCCCTTACTCCCTGCCCTTGG + Intergenic
1069773494 10:70913803-70913825 CTGCTTTCAGCCCCTCCACTGGG - Intergenic
1070816749 10:79329115-79329137 CTTCTCTTACTCCCTGCCCTGGG - Intergenic
1071356455 10:84801216-84801238 CTGCTCCCTCTCCATGGACTTGG + Intergenic
1071525339 10:86355005-86355027 CTCCTCTCACTTCCTGTTCTGGG - Intronic
1072896687 10:99373325-99373347 CTGCTCACACTCTCTTCCCTTGG + Intronic
1073285488 10:102385066-102385088 GGGCACTCACCCCCTGCACTGGG + Intergenic
1073919582 10:108443496-108443518 CTTCTCTCACTCCCTGGAAAAGG + Intergenic
1074038404 10:109763871-109763893 ATGCTCACACTCCCTACAGTGGG - Intergenic
1074038547 10:109765226-109765248 CACCTCTCTCTTCCTGCACTCGG + Intergenic
1074532507 10:114306711-114306733 CTGCTCTCCTTCCCAGGACTGGG - Intronic
1074908519 10:117886152-117886174 CTGCTCTCATTCCCCTCACCTGG + Intergenic
1074991291 10:118710643-118710665 CTGCACTCACTTCCCTCACTGGG + Intronic
1075124207 10:119686679-119686701 CTGCTTTCACTCCCCGCGCAGGG + Intergenic
1075517131 10:123118175-123118197 CTGCTCCCAGTCCAGGCACTGGG - Intergenic
1076143552 10:128098310-128098332 CTGGTGTCACTTCCTGTACTGGG + Exonic
1076240345 10:128900465-128900487 CTGCTCTCACTCCTTTAACCTGG - Intergenic
1076278621 10:129226007-129226029 CAGATCTGACTCCCTGCCCTGGG - Intergenic
1077002549 11:331528-331550 CTGCTCGTCCTCCCTGCTCTTGG - Intergenic
1077539947 11:3141802-3141824 GTCCTCCCAGTCCCTGCACTGGG - Intronic
1078544865 11:12240143-12240165 CTCCCCTCTCTCCCTGCACCAGG + Intronic
1080173283 11:29332079-29332101 CATCTCTCACTCCCTGCCATAGG - Intergenic
1081103000 11:39028603-39028625 TGGCTCTGACTCCCTGCGCTAGG - Intergenic
1081364167 11:42214442-42214464 CTGATCTCACCCCCAACACTGGG - Intergenic
1081621287 11:44620406-44620428 CTGCTCACACCCTCTGCCCTGGG - Intergenic
1081867434 11:46367350-46367372 CCGCTCTGACTCGCTGCACGGGG - Exonic
1082215023 11:49558787-49558809 TCGCTCTCCATCCCTGCACTGGG - Intergenic
1083492443 11:63022791-63022813 CTGCCCTCACCCCCAGCACCAGG - Intergenic
1084045528 11:66565830-66565852 CTGCTCTCCCTCTCTGAACAGGG - Exonic
1084096716 11:66916131-66916153 CAGCTCTCACTCACCACACTTGG + Intronic
1085200287 11:74697726-74697748 CTTCCCTCCCTCCCTGCACTGGG - Intronic
1085495019 11:76960986-76961008 GTGCTCTCAGATCCTGCACTGGG - Intronic
1085637589 11:78170339-78170361 CAGCTCTCAGTTCCTGCCCTAGG - Intergenic
1086634556 11:89065682-89065704 TTGCTCTCCATCCCTGCACTGGG + Intronic
1086933214 11:92716142-92716164 CTGCTACCACTACCTGCAGTTGG - Intronic
1088991317 11:114955996-114956018 CTGCTCTCATTCTCAGCAGTAGG + Intergenic
1089924466 11:122242868-122242890 CTGGTCACACTCCCTTCACAAGG - Intergenic
1090227996 11:125083068-125083090 CTGCCCTCCCTCCCAGCCCTGGG + Intronic
1092395406 12:8121660-8121682 ATCCTCTGACACCCTGCACTGGG - Intergenic
1093305097 12:17507138-17507160 ATGTTCTCACTCCCTTCACTGGG + Intergenic
1095632711 12:44397111-44397133 TTGCTCTCACTCCCTACCGTGGG - Intergenic
1095944715 12:47747291-47747313 CTGTTCTCACTTCCTCCATTGGG - Intronic
1098060104 12:66553009-66553031 CAGCTCTCACACCCTGTATTTGG + Intronic
1102572383 12:113834918-113834940 CTGATATCACTCTCTGCACATGG + Intronic
1102923307 12:116808854-116808876 CCACTCTCACCCCCAGCACTGGG + Intronic
1103082196 12:118033809-118033831 CAGCTCACACTCCCTCCGCTGGG - Intronic
1103611877 12:122129115-122129137 CTGCTCTCTGTCCCTGTCCTAGG + Exonic
1104047288 12:125172370-125172392 ATGGTCTGTCTCCCTGCACTAGG + Intergenic
1104669459 12:130670435-130670457 CTGCTCTCTCTCCTAGCTCTGGG + Intronic
1104719328 12:131036274-131036296 TGGGTCTCACTCACTGCACTGGG + Intronic
1104719363 12:131036491-131036513 CAGGTCTCACTCACTGCACCGGG + Intronic
1104719379 12:131036586-131036608 CAGGTCTCACTCACTGCACCGGG + Intronic
1104719439 12:131036867-131036889 CAGGTTTCACTCACTGCACTGGG + Intronic
1104719444 12:131036924-131036946 CAGGTCTCAGTCACTGCACTGGG + Intronic
1104719450 12:131037001-131037023 CGGGTCTCACTCACTGCACCAGG + Intronic
1104719460 12:131037059-131037081 CGGGTCTCACTCACTGCACCGGG + Intronic
1104719463 12:131037078-131037100 CGGGTCTCACTCACTGCACTGGG + Intronic
1104719490 12:131037207-131037229 CAGGTCTCACTCACTGCACTGGG + Intronic
1104719495 12:131037264-131037286 CAGGTCTCAGTCACTGCACTGGG + Intronic
1104719506 12:131037341-131037363 CGGGCCTCACTCACTGCACTGGG + Intronic
1104719514 12:131037399-131037421 CAGGTCTCAGTCACTGCACTGGG + Intronic
1104719525 12:131037472-131037494 CGGGCCTCACTCACTGCACTGGG + Intronic
1104719532 12:131037529-131037551 CAGGTCTCAGTCACTGCACTGGG + Intronic
1104719542 12:131037602-131037624 CGGGTCTCACTCACTGCACCAGG + Intronic
1104719552 12:131037660-131037682 CGGGTCTCACTCACTGCACTGGG + Intronic
1104719558 12:131037717-131037739 CAGGTCTCAGTCACTGCACTGGG + Intronic
1104719568 12:131037790-131037812 CGGGTCTCACTCACTGCACCAGG + Intronic
1104719577 12:131037848-131037870 CGGGTCTCACTCACTGCACCAGG + Intronic
1104804452 12:131576106-131576128 TGGCTCTCACTCACTGCAGTGGG - Intergenic
1104804456 12:131576144-131576166 CAGGTCTCACTCACTGCACCGGG - Intergenic
1104804459 12:131576182-131576204 CGGCTCTCACTCACTGCAGCAGG - Intergenic
1104804469 12:131576285-131576307 CGGCTCTCACTCACTGCACTGGG - Intergenic
1104804473 12:131576323-131576345 CAGGTCTCACTCACTGCACTCGG - Intergenic
1104804530 12:131576804-131576826 CGGGTCACACTCACTGCACTGGG - Intergenic
1104804535 12:131576838-131576860 CGGGTCACACTCACTGCACTGGG - Intergenic
1104811309 12:131621920-131621942 CTGGCCACACTCCCTGCACGGGG + Intergenic
1106548746 13:30753184-30753206 CTGCTCTCTATCACTGAACTTGG - Intronic
1107787133 13:43968644-43968666 CCGCTCTGACTCGCTGCACCGGG - Intergenic
1108322627 13:49302890-49302912 TTCCTGTCACTCCCTGCACCTGG - Intergenic
1108636715 13:52342590-52342612 ATGCTCTCCCTCCCTGCATCAGG - Intergenic
1108701767 13:52949905-52949927 CTGCTCCCAGTTCCTGCTCTTGG + Intergenic
1109750868 13:66689402-66689424 CTGTTCTCACTCACATCACTAGG + Intronic
1109872388 13:68350139-68350161 CTTCTTTCACTACCTGCACATGG - Intergenic
1110331735 13:74280662-74280684 CTGCTCTGACTCCATCCACAAGG - Intergenic
1113064420 13:106358988-106359010 CTTCTCTCTCTCCCTGTACCTGG + Intergenic
1113310501 13:109127381-109127403 CTGGTCTCCTTCGCTGCACTCGG + Exonic
1113394774 13:109937025-109937047 CTGGGCTCACTCTCTTCACTTGG - Intergenic
1113398793 13:109973098-109973120 CTGCTCCCCCTCCCTGTCCTGGG + Intergenic
1113707216 13:112442686-112442708 CTGCAGTCCCTCCCTGCACGGGG + Intergenic
1113734148 13:112665103-112665125 CTGCTCCCTTTCCCTGCACGGGG + Intronic
1113910264 13:113838359-113838381 CTGGTCTCCCTCCCTGCTCCAGG - Intronic
1114454783 14:22847434-22847456 CTCCTCTTGCTCCCTCCACTGGG - Exonic
1115963711 14:38863828-38863850 CTGCTCTCAGTCCCAGGTCTGGG + Intergenic
1116086229 14:40241689-40241711 TGGCTCTCAGTCCCTGCATTTGG + Intergenic
1116769804 14:49113982-49114004 CTTCTCTCTCACCCTGCATTAGG - Intergenic
1117931427 14:60845684-60845706 CTGCTTTCACTCCGAGCCCTAGG + Intronic
1117966692 14:61213738-61213760 CTGCTATTTCTCCCTGCACCTGG + Intronic
1118313376 14:64708742-64708764 CATCTCTCACTTCCTGAACTAGG - Intronic
1119020559 14:71108614-71108636 CAGCTCTCACTCTGTGCAGTCGG + Exonic
1120902331 14:89586657-89586679 CTGCCCGCATCCCCTGCACTGGG - Intronic
1121289800 14:92764682-92764704 CTGCTCTTTCTCCCTACAATGGG + Intergenic
1121291398 14:92778818-92778840 CTGCTCTTTCTCCCTACAATGGG - Intergenic
1122874274 14:104656338-104656360 CTGTTCTCCCTCCCTCCGCTGGG - Intergenic
1123088251 14:105728872-105728894 CTGCACCCATTACCTGCACTGGG + Intergenic
1123833584 15:24166175-24166197 CTGATATCACCCCCTGCACTGGG - Intergenic
1123853258 15:24381752-24381774 CTGATATCACCCTCTGCACTGGG - Intergenic
1125228642 15:37426632-37426654 CTACTCTCTCTCCCTGCTTTTGG - Intergenic
1125501699 15:40243828-40243850 CGGCTCTCGATCCCTTCACTAGG - Intronic
1125686740 15:41568054-41568076 CTGCTCTCACCCACTGTGCTGGG - Intronic
1125725706 15:41867149-41867171 CTGCTCTCCCACCCTGGGCTGGG + Intronic
1127932451 15:63605886-63605908 CTGGTCTCTCTGCCGGCACTGGG - Intergenic
1128886844 15:71295813-71295835 CCACTCCCACTCCCTGCCCTAGG + Intronic
1129692952 15:77724083-77724105 CTTCTCCCACTCCTTGCACCCGG + Intronic
1132831950 16:1932791-1932813 CTGCTCTCACCTGCTGGACTAGG + Intergenic
1135387649 16:22057970-22057992 CTAATCTCACTCCCCCCACTTGG - Intronic
1136556741 16:31011408-31011430 CTCCTCCCACCCCCTGCAATGGG + Intergenic
1137875021 16:51988032-51988054 CTTCTCTCCCTCCCTCCACATGG + Intergenic
1138104113 16:54278064-54278086 CTGCACTCTCTCACTGCACCAGG - Intergenic
1138703098 16:58885887-58885909 TTTCTCTCACTCTCTGCTCTGGG - Intergenic
1139573951 16:67829734-67829756 CACCAGTCACTCCCTGCACTGGG + Intronic
1139662552 16:68431000-68431022 CTGTCCCCACTCCCTGCACAGGG - Intronic
1139981551 16:70862870-70862892 CTGAACTCTGTCCCTGCACTAGG - Intronic
1140208284 16:72950962-72950984 CTTCTCTCCTTCCCTGCAGTGGG - Exonic
1140882063 16:79207420-79207442 CTGTTCTCCTTCCCTGCTCTTGG + Intronic
1141884189 16:86880478-86880500 CTTGTCTCCCTCCCTGCACGTGG - Intergenic
1142677274 17:1521609-1521631 CTGCTGTCATTCCTTTCACTGGG + Exonic
1142756642 17:2020307-2020329 CTTCTCTCACTCTCGCCACTGGG + Intronic
1143409543 17:6700576-6700598 CTGCTCTTCCTCCCTGTGCTGGG + Intronic
1143732169 17:8887382-8887404 TGGCCCTCACTCCCTGCACTTGG - Intronic
1145961226 17:28887561-28887583 CTGCTCTCCCTTCCTGCTCCAGG - Intronic
1146662425 17:34673682-34673704 CTGCTCACAGCCCCAGCACTGGG + Intergenic
1148687588 17:49509352-49509374 CTGCTTTCCCTCCCTGCCCCAGG + Intronic
1149361664 17:55901755-55901777 CTTCTCTCACCTACTGCACTGGG - Intergenic
1149455065 17:56781121-56781143 GTGCTCTCAGCCACTGCACTGGG + Intergenic
1150436215 17:65156362-65156384 CTGCTTTCCTTCCCTGCACACGG + Intronic
1150620636 17:66805458-66805480 GTGCTTTCCCTCCCTGCACATGG + Exonic
1151657309 17:75502071-75502093 TGGCTCTCTCTCCCGGCACTTGG + Exonic
1151772876 17:76176834-76176856 CTGCTCCCACTTCCTGCCCGGGG - Intronic
1151906856 17:77054463-77054485 CTCCACTCTCTCCCTGCCCTAGG + Intergenic
1152514661 17:80816326-80816348 CTGCTCTCTGGTCCTGCACTGGG - Intronic
1155052147 18:22157852-22157874 CTTCTCTCACGCACTGCTCTAGG - Intergenic
1155663650 18:28281711-28281733 CTGGTCTCAGTCCCTGGTCTGGG - Intergenic
1156483380 18:37449936-37449958 CTGCTCTCACTGCCTGTCCTGGG - Intronic
1156636605 18:39038335-39038357 CTTCTCTTACTCTGTGCACTTGG - Intergenic
1157616666 18:48991384-48991406 CTGCCCTCTCTCCATGCTCTGGG + Intergenic
1157713253 18:49864403-49864425 CTGCCATTACTCCCTGCCCTAGG + Intronic
1157789675 18:50520427-50520449 CTGCTCTCTCCACCTGCAATTGG - Intergenic
1160008336 18:75085144-75085166 CTGCTCTCTTTTCCTGCCCTCGG + Intergenic
1160755752 19:756343-756365 ATGCTCTCACTGGCTGGACTAGG + Intronic
1163266970 19:16227427-16227449 CTGCTCTCAGTGCGTGGACTGGG + Intronic
1165154873 19:33780896-33780918 CTGCTCTCAGGCCCTGCACGCGG - Intergenic
1165845415 19:38815172-38815194 CTGGTCTCCCTGCCTGCCCTGGG - Intergenic
1166001938 19:39882747-39882769 CTGCTCTCTGTCCCTGCCCCTGG + Intronic
1166004721 19:39898998-39899020 CTGCTCTCTGTCCCTGCCCCTGG + Intronic
1166148456 19:40852951-40852973 ATTCTCTCACTCCATGCTCTAGG - Intronic
1166152597 19:40884736-40884758 ATTCTCTCACTCCATGCTCTAGG - Intronic
1166299099 19:41904130-41904152 CTGCCCCAACACCCTGCACTAGG - Intronic
1167095550 19:47373320-47373342 GTGGTCTGTCTCCCTGCACTGGG - Intronic
1167820880 19:51926831-51926853 CTGCTCTCTTTACCTGCACTGGG + Intronic
925915070 2:8599358-8599380 CTGCTCCCACTCCCACCACCTGG - Intergenic
926126114 2:10272853-10272875 CTTGTTTCCCTCCCTGCACTGGG + Intergenic
927507276 2:23622675-23622697 CTGCTCCTCATCCCTGCACTTGG + Intronic
927670633 2:25065921-25065943 CTGCTCTCCCTCCCTTCATGCGG - Intronic
927709208 2:25314599-25314621 CTGCACTCACTTCCTCCACGTGG - Intronic
928588459 2:32787854-32787876 CTGCTATCTCTCCATTCACTTGG - Intronic
929266799 2:39927492-39927514 CTGCCATCTCTCCCTGCCCTAGG + Intergenic
929938169 2:46310120-46310142 CAGCTCCCACTCCATGCACTAGG - Intronic
930471696 2:51823992-51824014 CTCTTCTCTCTCCCTGCCCTTGG + Intergenic
930775361 2:55165412-55165434 CTGCACTCACTCCCTGTACTGGG + Intergenic
930942473 2:57028964-57028986 CTGCTCTCAGTCCCAGCTCTGGG + Intergenic
937394374 2:121521644-121521666 CTGCTCTGAGTCACTGCATTCGG + Intronic
937450654 2:121999823-121999845 CTGCTCTGCCTTCCTGGACTAGG + Intergenic
937854674 2:126663700-126663722 CTGCACCCTCTCCCTGCCCTGGG + Intronic
938241733 2:129747625-129747647 CTGCTCTCAGTCCCAGGTCTGGG - Intergenic
940951495 2:159680579-159680601 CTGCTGTCACTGCCTGCTTTTGG - Intergenic
942438820 2:176010048-176010070 CTGCTCTTACTCCATGCTCTTGG - Intergenic
944114712 2:196173670-196173692 CTGCTCTCATTCCCTTGAGTAGG + Intronic
945144947 2:206728349-206728371 CCTCTCTTACTCCCTACACTGGG + Intergenic
947577742 2:231289855-231289877 CTTCTCTCACTGCCATCACTGGG + Intronic
947841415 2:233210159-233210181 ATGCTCTTCCTCCATGCACTTGG + Intronic
948463895 2:238143140-238143162 CTGCTCCCTCTCCCTGCAGCCGG + Intronic
948505097 2:238423026-238423048 CTGCTGCCAGTCCCTGCTCTGGG + Intergenic
1170269506 20:14508510-14508532 CTGCTCTCTCTCCCTCCCTTGGG - Intronic
1170596729 20:17811225-17811247 CTGCTCTCTCCTCCTGCACAGGG - Intergenic
1171117435 20:22537127-22537149 CTGCTCTCCCTGCCTCCAGTAGG + Intergenic
1173665653 20:44761366-44761388 CTGCTCTCACACCTGCCACTAGG + Intronic
1173823733 20:46034378-46034400 CTGGTTTGTCTCCCTGCACTTGG + Intronic
1173836719 20:46130656-46130678 CTGCCCTCACAGCCTCCACTGGG - Intergenic
1174207962 20:48854860-48854882 ATCATCTCACTCACTGCACTGGG - Intergenic
1174597240 20:51693807-51693829 GAGAGCTCACTCCCTGCACTCGG + Intronic
1175178335 20:57127325-57127347 CTCCTCTCACCACCTGCACAAGG + Intergenic
1175573215 20:60039770-60039792 CTGAACTCACTCCCTGCTCAGGG + Intergenic
1175822307 20:61916963-61916985 GTGCTCTCCTTCCCTGCACAGGG - Intronic
1176386868 21:6142490-6142512 CAGCTCTCTCTCCATGCAGTGGG + Intergenic
1177062226 21:16390205-16390227 CTACTCTCACTCCCTGATTTGGG + Intergenic
1177445528 21:21190657-21190679 CTCTTCTCACTTTCTGCACTAGG - Intronic
1179418244 21:41215435-41215457 CTGCTCTCACCCCATGCCCCAGG + Intronic
1179428535 21:41302880-41302902 CTGCTGTAACTTCCTACACTGGG + Intergenic
1179736605 21:43395762-43395784 CAGCTCTCTCTCCATGCAGTGGG - Intergenic
1180693642 22:17738397-17738419 CTGCAATCACTCCCTGCAGGGGG + Intronic
1180800199 22:18628201-18628223 CTGCTGGCACTCTCTGCACTGGG - Intergenic
1180851432 22:19023765-19023787 CTGCTGGCACTCTCTGCACTGGG - Intergenic
1181221517 22:21367065-21367087 CTGCTGGCACTCTCTGCACTGGG + Intergenic
1181272979 22:21671239-21671261 CTGCTGTCACTGCCTGGAATGGG + Intronic
1181274145 22:21677897-21677919 CGGCTCTCCCTCCCTGCAGCGGG - Intronic
1181983346 22:26782033-26782055 CTGCCCTCCTTCCCTGCCCTGGG + Intergenic
1182387792 22:29960952-29960974 CTGCTCCCACTCTCTTCCCTAGG + Intronic
1182857286 22:33529030-33529052 CTTATCTCACTCCCTACACGTGG + Intronic
1183750768 22:39719181-39719203 CTGCTCACACTCCCTGCCCAGGG + Intergenic
1184484045 22:44765539-44765561 CTGTCCTCACTCCCACCACTTGG - Intronic
1184503642 22:44888508-44888530 CTGGTCCCACTCCCAGCACATGG - Intronic
1185341396 22:50292911-50292933 CAGAACTCCCTCCCTGCACTGGG + Intronic
949775616 3:7629457-7629479 GTGCTCTCTCTTTCTGCACTGGG - Intronic
950366677 3:12490755-12490777 CTGCTCCCACTCCCGGCCCAAGG + Intronic
950989734 3:17419965-17419987 CTGGTCTAAGTCCCTGCACCTGG + Intronic
951301719 3:21006575-21006597 ATGCTCCCTCTCCCAGCACTAGG + Intergenic
952952014 3:38533026-38533048 GTGCTCTCTCTCCCTGCATGAGG + Intronic
958468097 3:94483279-94483301 CTCCTGGCACTCCCTGCCCTGGG - Intergenic
959389804 3:105759680-105759702 CTGCTCACAGTGCCTGCTCTGGG - Intronic
959583696 3:108006417-108006439 CTGTGCTCACACCCTGCTCTGGG - Intergenic
960574692 3:119218246-119218268 CTGCTGGCACTCCCTGCAGGGGG + Intronic
960596227 3:119410489-119410511 CTGCCCTAACTCCCAGCACATGG - Intronic
961306145 3:125959904-125959926 CGGCTCTCACTCCTTGTCCTGGG + Intergenic
961934657 3:130570568-130570590 CTCGTCCCACTCCCTGCAGTGGG + Intronic
962616726 3:137133942-137133964 CTGCTCTCATGTCCTGGACTGGG + Intergenic
962711927 3:138094739-138094761 CAGCTCTGACTCCCAGCTCTGGG + Intronic
963847252 3:150171726-150171748 CTGCTCTGACTCCCTCCATCTGG - Intergenic
966537590 3:181051768-181051790 CTGCTCTCTCTCTCTGAAGTCGG - Intergenic
967906749 3:194507798-194507820 CTGCTCTTCCTCCCAGTACTCGG + Intergenic
968812783 4:2807651-2807673 CTGCTTTCCCTTCCTGCCCTGGG - Intronic
969906083 4:10397061-10397083 CTGCTCTCAGTCCCTGGTCTGGG + Intergenic
969931645 4:10636667-10636689 CAGCTCTCATACCGTGCACTTGG + Intronic
970457573 4:16240102-16240124 CTCCTCTCACTTCCTGCCCTAGG - Intergenic
972285711 4:37645960-37645982 CTGCCCTCAGGCCCTGCCCTGGG - Intronic
973550368 4:52029066-52029088 CTGTTCTCCCTCCATCCACTTGG + Intronic
977936929 4:102817071-102817093 CTTCTCTCACTCCTTGTTCTTGG - Intronic
978110190 4:104953992-104954014 CTACTCTTACTCCCATCACTAGG + Intergenic
981771217 4:148310896-148310918 ATGATCCCACTCCCTGCACATGG + Intronic
982763581 4:159317431-159317453 CTGCACTCACTGCCTGCAATAGG - Intronic
984894555 4:184526359-184526381 CTGCTCCGAATCCCTGCACTAGG + Intergenic
985212300 4:187608177-187608199 CTGCTCTAACACCTTGCAGTGGG + Intergenic
986290615 5:6396426-6396448 TTGCTCTCACTCTCTCCACCAGG - Intergenic
990374402 5:55154701-55154723 ATTCTCTCAGTCCCTGCACTAGG + Intronic
990383035 5:55233903-55233925 CTACTCCCACTCCGTGCACCGGG - Intergenic
990482772 5:56228051-56228073 CTCTTCTCACTCCCTGCAATGGG + Intronic
992158780 5:73980677-73980699 CTGCTCTCTCACTCTGGACTGGG - Intergenic
993830533 5:92752415-92752437 ATGCTCTCCCTCCCTGCAACAGG - Intergenic
994210575 5:97083946-97083968 CTGCTCTCATTCCCTGCCCCGGG - Intergenic
995005487 5:107189547-107189569 CAGCTCTGACTCTCTGCATTTGG - Intergenic
995031512 5:107487174-107487196 CTGCTCTGCCTCCATGAACTGGG + Intronic
995409305 5:111836646-111836668 ATGCTCTCTCTCCCTTCTCTGGG - Intronic
995624022 5:114056881-114056903 CTGCCCTCTCTCCCTTCATTTGG - Intergenic
997695593 5:135858355-135858377 TTACTCTCCCTCCATGCACTTGG - Intronic
997744400 5:136286490-136286512 TTGGTCTCTCTCCCTGCACGTGG - Intronic
1002212621 5:177607841-177607863 CAGCTCTCCTTCCCTGCACTGGG + Intronic
1003385815 6:5666482-5666504 CTGCTCTCTCTCCTTGCAACTGG - Intronic
1004529624 6:16441282-16441304 CTTCTCTGCCTCCCTTCACTTGG - Intronic
1004550292 6:16640342-16640364 CTGTTCTCTCTCCCTCCTCTCGG + Intronic
1005075609 6:21903535-21903557 CTTCTCTCCCTCCATGCCCTGGG - Intergenic
1006458186 6:34143827-34143849 CTGGTCTCCCTGCCTGCCCTAGG + Intronic
1007760694 6:44131989-44132011 CTGCTCTCAAAGCCAGCACTGGG - Intronic
1008537742 6:52519980-52520002 TTCCTCTCACTCCCAGCCCTTGG - Intronic
1013851955 6:114526951-114526973 CTGCTCTTTCTGCCTGCATTAGG + Intergenic
1014322110 6:119942873-119942895 CTGCTCTCAGTCCCAGGTCTGGG + Intergenic
1015188706 6:130448902-130448924 CTCCTCTAACTCCCTGCAATTGG - Intergenic
1016749990 6:147621710-147621732 CTGCTCTCCCTCCCTTCTGTGGG + Intronic
1017162417 6:151378137-151378159 CTACTCTCCCTTCCTGCTCTAGG + Intronic
1017391313 6:153942538-153942560 CTGTTCTCACTCCCTACCCTAGG + Intergenic
1018391487 6:163344928-163344950 CTGCCCTCCCTCTCTGCACAGGG - Intergenic
1018446157 6:163860820-163860842 CTGCCCTCACTTGCTGCTCTGGG - Intergenic
1019386467 7:759270-759292 CTGGCTTCACTCCCTGCCCTGGG + Intronic
1019491252 7:1314608-1314630 CTGCTCTCCCTGTCTGCACTGGG + Intergenic
1021075014 7:16292379-16292401 CTTCTCTTACTTCCTCCACTTGG - Intronic
1021554117 7:21902625-21902647 CTGAACTCTCTCTCTGCACTAGG + Intronic
1022525620 7:31035188-31035210 CAGCTCCCAGTCCCTCCACTGGG - Intergenic
1032062471 7:128736572-128736594 CTGCTCTCACTCGATGGCCTCGG + Intergenic
1032179925 7:129666256-129666278 CTTCCCTCCCTCCCTCCACTGGG + Intronic
1032682910 7:134203758-134203780 CTGCTCAGAATCTCTGCACTGGG + Intronic
1032843878 7:135736354-135736376 ATCCTCTGACTCCATGCACTAGG - Intronic
1033293833 7:140113526-140113548 GTGCTTTCACTCCCTGTACTAGG + Exonic
1034120774 7:148625685-148625707 CTGCTTTCACTCCCTGCAGATGG - Intergenic
1034315355 7:150125969-150125991 CTGCTCTCTCTGGCTGAACTGGG + Intergenic
1034380065 7:150684138-150684160 CTGGTCTCACTCCCAGCAACTGG - Intergenic
1034450250 7:151133427-151133449 CCACCCTCCCTCCCTGCACTCGG + Intronic
1034791539 7:153974825-153974847 CTGCTCTCTCTGGCTGAACTGGG - Intronic
1035291333 7:157841072-157841094 CTGCACTCGCTCCCAGCACAGGG + Intronic
1036152317 8:6309905-6309927 GAGCCCTGACTCCCTGCACTTGG - Intergenic
1036773119 8:11592439-11592461 CTCGGCTCACTCCCTGCCCTGGG + Intergenic
1037390496 8:18387155-18387177 CTCCCCGCGCTCCCTGCACTGGG - Intergenic
1038011501 8:23480142-23480164 CTGATCTCACTCCCAGTATTTGG - Intergenic
1038192857 8:25339695-25339717 CCGCTCTCTCTCCCGACACTGGG - Intronic
1039944277 8:42116552-42116574 CAGCTCTAACACCCTGCACCTGG + Intergenic
1042253107 8:66775551-66775573 CGGCACTCATTCACTGCACTTGG + Intronic
1042758478 8:72244765-72244787 CAGCTCTCTCTGCCTGCACCAGG - Intergenic
1044620995 8:94190662-94190684 GTCTTCTCACTCCCTGAACTGGG + Intronic
1045245743 8:100440392-100440414 CTGCTCTCTCGACCTCCACTTGG - Intergenic
1045804402 8:106140430-106140452 CTCCTCTCACCCTCTGCACATGG - Intergenic
1047013558 8:120698756-120698778 CTGCTTTCACTCCCTGCCTGGGG - Intronic
1047187553 8:122647564-122647586 CTCCTCTAACTTCCTGTACTGGG + Intergenic
1048162483 8:132033824-132033846 CTGTTCTCTTTCCCTGTACTGGG - Intronic
1051396388 9:16626436-16626458 TTGCTCTGTCTGCCTGCACTGGG - Intronic
1052050944 9:23849547-23849569 CAGCTCTGACTTCCTGAACTCGG - Intergenic
1052838145 9:33266492-33266514 ATGCTCACAGCCCCTGCACTAGG - Intronic
1053149442 9:35733205-35733227 CAGCTCTCACTCTCTGCAAAAGG - Exonic
1053274188 9:36770929-36770951 CTGCTCTCACTCCAGGCCTTCGG + Intergenic
1055667590 9:78567999-78568021 CTTCTCTCACTCTCTGCATTTGG + Intergenic
1058651732 9:107181382-107181404 CTGCACTCACTTCCTCCACAAGG + Intergenic
1061194600 9:129100849-129100871 CTGAACCCACACCCTGCACTTGG - Intronic
1061417229 9:130453685-130453707 CAGCCCTCACTCCCTTCATTCGG - Intronic
1061484777 9:130914717-130914739 CAGCGCTCACTCCCACCACTGGG + Intronic
1061628231 9:131855086-131855108 CCGTGCTCACACCCTGCACTCGG - Intergenic
1061897805 9:133657600-133657622 CTGCTCACACCACCTGCATTTGG - Intronic
1061924326 9:133798512-133798534 CTTCTCCCTCTCCCTGCACTGGG + Intronic
1062202325 9:135310050-135310072 CAGCTCTTCCTCCCTGCCCTGGG - Intergenic
1062551495 9:137089538-137089560 CTGCTCCCTCTCCCAGCCCTGGG - Intronic
1185978736 X:4751006-4751028 CTGGGCTCACTCCATACACTTGG + Intergenic
1186057360 X:5664180-5664202 CCGCTCTCTCTCTCTCCACTTGG + Intergenic
1186992142 X:15081864-15081886 GTGCTATCACTCTCTGCAGTTGG + Intergenic
1187085191 X:16035246-16035268 ATGCTCTGTCTCCCTTCACTTGG + Intergenic
1188515186 X:30977848-30977870 CTGCTTTCATTCTCAGCACTCGG + Intergenic
1190915682 X:54809508-54809530 CTTCTCTCCCTCCCTCCACTGGG - Intronic
1192638405 X:72842597-72842619 CTTCTCCCGCTCCCTGTACTAGG - Intronic
1192643309 X:72878211-72878233 CTTCTCCCGCTCCCTGTACTAGG + Intronic
1193951397 X:87804408-87804430 CTGCTCTCAGTCCTTGCTATGGG + Intergenic
1194157044 X:90404202-90404224 CTGCTCTCAGTCCCAGGTCTGGG - Intergenic
1196744821 X:119061947-119061969 CTGCCCTCACTCCCAGCCCCTGG - Intergenic
1198296708 X:135294250-135294272 CTGCTCTCCCTCAGTGCTCTTGG - Exonic
1200243040 X:154507720-154507742 CTGCTCTCTCTGTCTGTACTTGG - Intronic
1200323787 X:155216703-155216725 CTGCTCTCACCCCTCGCACCTGG + Intronic
1200622071 Y:5462556-5462578 ATGGTCTCAATCCCTGAACTTGG - Intronic
1200926947 Y:8663219-8663241 CTGCTCACACTCTATGCCCTAGG - Intergenic