ID: 923406030

View in Genome Browser
Species Human (GRCh38)
Location 1:233661551-233661573
Sequence AAGGAGGCACAGATGGTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 585}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923406030 Original CRISPR AAGGAGGCACAGATGGTAAG AGG (reversed) Intronic
900007413 1:71317-71339 AAGGAGAGTCAGATGATAAGAGG + Intergenic
900754763 1:4425967-4425989 GAGGAGGCACAGGCGGAAAGGGG - Intergenic
900941671 1:5802449-5802471 AAGGTCACACAGCTGGTAAGTGG - Intergenic
901229639 1:7634565-7634587 AAGGAGGGAGAGAGGGAAAGAGG + Intronic
902559473 1:17267980-17268002 AACAGGGCACAGATGGCAAGGGG - Intronic
902761625 1:18584598-18584620 AAGGTCACACAGCTGGTAAGTGG + Intergenic
903370728 1:22833860-22833882 AATGAGGCACAAAGGGTAAAAGG + Intronic
903414910 1:23175932-23175954 AAGGTCACACAGCTGGTAAGTGG + Intronic
904493600 1:30874789-30874811 AAGGACACACAGCTAGTAAGTGG + Intronic
905257475 1:36694309-36694331 AAGGAGGCACAGATAGTAAAGGG + Intergenic
905309842 1:37041743-37041765 AGGGATGCTCAGCTGGTAAGAGG - Intergenic
905321967 1:37124218-37124240 AAGGACACACAGCTGGTAAGTGG + Intergenic
905787112 1:40767183-40767205 TATGAGTCACAGATGGTGAGGGG + Intronic
906059236 1:42937578-42937600 AAGGACACACAGCTAGTAAGTGG - Intronic
907104269 1:51866874-51866896 AAGAAGGCAGAGAAGGTAATGGG + Intronic
907443747 1:54494451-54494473 AAAGAAGCACAGTTGGTGAGTGG + Intergenic
907560725 1:55385181-55385203 AAGGTCACACAGCTGGTAAGTGG - Intergenic
907712478 1:56896996-56897018 AAGGTGACACAGCTGGTCAGAGG + Intronic
907775434 1:57509736-57509758 GAGGAGACACAGAGGGTAAGTGG - Intronic
907933749 1:59023381-59023403 AAGGAGGCAGAGGTGGGCAGAGG + Intergenic
908009036 1:59756816-59756838 AAGGTGGCAAAGATGGTCAGGGG + Intronic
909509842 1:76439854-76439876 AAAGTGACACTGATGGTAAGTGG - Intronic
909971533 1:81996820-81996842 AAGGTCTCACAGCTGGTAAGTGG + Intergenic
910355393 1:86346931-86346953 AAGGTCGCACAGCTAGTAAGTGG - Exonic
910399795 1:86827036-86827058 AATGAGGCACAGCTGGGTAGAGG + Intergenic
910489572 1:87754097-87754119 AAGGACACACATCTGGTAAGTGG + Intergenic
910549190 1:88456593-88456615 GAGGAGACAAAGATGGGAAGAGG - Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911080827 1:93928501-93928523 CAGGAGGAAGAGAGGGTAAGTGG - Intergenic
912198189 1:107424594-107424616 AAGGTGGTAGAGATGGTGAGAGG + Intronic
912229113 1:107771817-107771839 CAGGAGGCACAGATGATATTCGG + Intronic
912325295 1:108752605-108752627 AAGGAGCCACAGCTATTAAGTGG - Intronic
912420967 1:109542151-109542173 AAGGTCGCACAGCTAGTAAGCGG - Intronic
913054720 1:115147768-115147790 ATGGAGACTCAGAGGGTAAGGGG + Intergenic
913187600 1:116383539-116383561 AAGGATACACTGCTGGTAAGTGG + Intronic
914363542 1:146957577-146957599 ACGGTGGCACAGATGGAAGGTGG + Intronic
914488135 1:148129557-148129579 ACGGTGGCACAGATGGAAGGTGG - Intronic
915160255 1:153914450-153914472 AAGGTCACACAGATGGTAAATGG + Intronic
915202973 1:154246833-154246855 ATGGAGACACAGCTAGTAAGTGG - Intronic
915276044 1:154788912-154788934 AAGGTCACACAGCTGGTAAGTGG + Intronic
915518223 1:156426051-156426073 AAGGTGGCAGAGATGGTAGAGGG + Intronic
915775009 1:158473787-158473809 AAGGAAGCAGAGAGGGAAAGAGG - Intergenic
915775028 1:158473857-158473879 AAGGAAGCAGAGAGGGAAAGAGG - Intergenic
915775037 1:158473892-158473914 AAGGAAGCAGAGAGGGAAAGAGG - Intergenic
916478622 1:165194424-165194446 AAAGAGGCACAGAGGGGAAGGGG - Intergenic
917146723 1:171900187-171900209 AAGGAGGGACAGATTCAAAGAGG + Intronic
917644105 1:177013008-177013030 TCAGAGGCAAAGATGGTAAGGGG + Intronic
918446476 1:184622215-184622237 AAGGAGGAAGGGAGGGTAAGTGG + Exonic
918465795 1:184820353-184820375 AAGTAGGCACAGAGGGAGAGTGG - Intronic
919236396 1:194849849-194849871 AAGGAAGCAAAGATGATAAAAGG - Intergenic
920032823 1:203047800-203047822 AAGGTCACACAGGTGGTAAGAGG + Intronic
921562146 1:216671624-216671646 AAGGTCTCACAGCTGGTAAGTGG + Intronic
922020538 1:221700031-221700053 AAAGAGGCAAAGAGGGAAAGAGG + Intergenic
922621123 1:226988984-226989006 AAAGAGGCCCAGAGGTTAAGTGG + Intergenic
922804056 1:228376764-228376786 GAGGAGGGGCAGATGATAAGAGG - Intronic
923406030 1:233661551-233661573 AAGGAGGCACAGATGGTAAGAGG - Intronic
923978673 1:239295196-239295218 AAGGAGGTAAAGGTGGTCAGGGG - Intergenic
924239771 1:242029936-242029958 AAGGAGGCACAGAGAGGTAGGGG + Intergenic
924596982 1:245454965-245454987 AAGGAGAAACACATGGTAGGTGG + Intronic
924854536 1:247863134-247863156 AAGGAGGTAGAGATGGAAAATGG + Intronic
1065183533 10:23150237-23150259 AAGGCTGCACAGCTGGCAAGTGG - Intergenic
1065866492 10:29919413-29919435 GAGGAGGAAGAGAGGGTAAGAGG - Intergenic
1065992397 10:31025180-31025202 AAGGAGGAACAGAAGGAAGGAGG + Intronic
1066055213 10:31674248-31674270 AAGGAGGCTGAGACTGTAAGAGG + Intergenic
1066057165 10:31692697-31692719 ATGGGGGAACAGCTGGTAAGTGG + Intergenic
1067552903 10:47247650-47247672 ATGGAGGCAGAGATGGTGACGGG + Intergenic
1068895498 10:62195479-62195501 AAGGAGAGACAGAAGGAAAGTGG + Exonic
1069225035 10:65932539-65932561 AAGGTAACACAGATAGTAAGAGG + Intronic
1069548966 10:69349259-69349281 ATGGAGGCTCAGAAGTTAAGTGG - Intronic
1069569548 10:69486040-69486062 AAGGTGGCACAGCTAGTATGAGG - Intronic
1069875513 10:71560554-71560576 AAGGTCGCACAGATTGTAAGTGG - Intronic
1069899453 10:71698895-71698917 AAGGTCACACAGCTGGTAAGTGG - Intronic
1070130826 10:73654292-73654314 AAGGAGACACTGTAGGTAAGAGG + Intronic
1070320623 10:75352179-75352201 AAGGAGGCAGAGATGCAAAGGGG + Intergenic
1070651479 10:78240104-78240126 AAGGAAGCACAGCTGGTACCAGG + Intergenic
1070694017 10:78548487-78548509 AAGGAGGAATGGATGGAAAGAGG + Intergenic
1071317374 10:84415572-84415594 AAGGAGGCACCTGTGGGAAGTGG + Intronic
1071423545 10:85525972-85525994 AAGGAGGCACAGGTAGGAAGAGG + Intergenic
1071713838 10:88075290-88075312 AAGGTGGCAAAGCTGGTCAGCGG - Intergenic
1071912137 10:90248258-90248280 AAGTAGGCACAGAAAGAAAGAGG + Intergenic
1071981695 10:91010003-91010025 AAGGGGACAGAGATGGGAAGAGG - Intergenic
1071981825 10:91010921-91010943 AAGGTCGCGCAGCTGGTAAGTGG - Intergenic
1072138077 10:92565937-92565959 AAGGATACACAGCTAGTAAGTGG - Intronic
1072519149 10:96214921-96214943 AAGGTGGCATAGCTGGTAACGGG + Intronic
1072555361 10:96510648-96510670 AAGGATACACAGCTTGTAAGTGG + Intronic
1073175683 10:101555624-101555646 AATCATGCAGAGATGGTAAGTGG - Exonic
1073339550 10:102734748-102734770 AAGATGGCACAGCTAGTAAGTGG + Intronic
1073767181 10:106695512-106695534 AAGACCGCAAAGATGGTAAGTGG - Intronic
1074081869 10:110174374-110174396 ATTGAGGCACAGCTGGTAAGTGG - Intergenic
1075084546 10:119405691-119405713 AAGGATGCAGAGCTGGAAAGTGG - Intronic
1075166748 10:120075060-120075082 AAGGAGACACAGCCAGTAAGTGG + Intergenic
1075394431 10:122116472-122116494 AAGGTCACACAGCTGGTAAGGGG - Intronic
1075570690 10:123540321-123540343 AAGGAGGGACAGATTGGAAAAGG - Intergenic
1076734299 10:132451896-132451918 AAGGTGGCACGGAAGGCAAGAGG + Intergenic
1077497490 11:2893189-2893211 AAGGACACACAGCTAGTAAGAGG - Intronic
1078397422 11:10993371-10993393 CAGGAGGCACAGATCATAGGAGG + Intergenic
1078602690 11:12747835-12747857 ATGTAGGCACAGGTAGTAAGTGG + Intronic
1079928348 11:26524769-26524791 AACAAGGCACAGATGATAACGGG - Intronic
1080062604 11:27972967-27972989 CAGCAGGCACAGATGGCTAGTGG - Intergenic
1080104120 11:28494034-28494056 AAGGACACACAGCTAGTAAGTGG - Intergenic
1081333635 11:41835761-41835783 AAGGAAACACAGTTTGTAAGTGG - Intergenic
1081432132 11:42988022-42988044 AAGAAGACACAGAGAGTAAGTGG + Intergenic
1081753585 11:45529260-45529282 AAGGAGGGAGAGAAGGGAAGTGG + Intergenic
1083153647 11:60809487-60809509 AAGGTGGCACAGCAGGTGAGTGG + Intergenic
1083198543 11:61105359-61105381 AAGGTCGCCCAGTTGGTAAGTGG - Intronic
1083218945 11:61239741-61239763 CAGGAGGCAGAGGTTGTAAGAGG - Intergenic
1083448140 11:62724374-62724396 CAGCAGGCTCAGATGGTGAGCGG - Exonic
1084028841 11:66468890-66468912 AAGGGCACACAGCTGGTAAGTGG + Exonic
1084434031 11:69127547-69127569 GAGGAGGCACAGGTGATAACTGG + Intergenic
1085016194 11:73175608-73175630 AAGGCCGCACAGATGGTAGATGG + Intergenic
1085029765 11:73264009-73264031 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1085040540 11:73324011-73324033 AGGGTGACACAGATGGTCAGAGG - Intronic
1085250551 11:75140791-75140813 AAGGACACACAGGTGGTACGTGG - Intronic
1085250795 11:75142378-75142400 AAGGTCACACAGTTGGTAAGAGG - Intronic
1086038970 11:82451829-82451851 AAGGTGACACAGCTGGTAAATGG - Intergenic
1086096745 11:83058039-83058061 AAAGAGGTAAAGATGGTGAGAGG - Intronic
1086400432 11:86457040-86457062 AGGGAGGCATCGATGGTAACAGG - Intronic
1087954716 11:104271383-104271405 TAGGAGACACAGGTGGTAACTGG - Intergenic
1088183896 11:107142396-107142418 AAGGAGGAAAAGAGGGAAAGGGG - Intergenic
1088385567 11:109250848-109250870 AGGGTGGCACAGATGGTGAAGGG + Intergenic
1088591718 11:111409061-111409083 AAGGAGGAAGAGATGGGAATGGG + Intronic
1088790364 11:113220311-113220333 GAGAATGCACAGATGGTATGTGG - Intronic
1088840848 11:113626523-113626545 AAGAAGGCAAAGATGGGAACAGG - Intergenic
1089260393 11:117220198-117220220 AAGGAGGCAGAGATAGGAAAGGG + Intronic
1089983442 11:122791283-122791305 AAGGCCACACAGCTGGTAAGTGG - Intronic
1090500774 11:127258451-127258473 AAGGAAGAGCAGATGGTGAGAGG - Intergenic
1090934529 11:131329756-131329778 AAGGAGGCACCGAAGCTAAGGGG + Intergenic
1091258008 11:134208080-134208102 AAGGACCCACAGCTAGTAAGTGG + Intronic
1093395124 12:18671610-18671632 GAGGAGGCACATATGGCTAGTGG + Intergenic
1093768909 12:22997480-22997502 ACTGAGGCACAGTTAGTAAGTGG + Intergenic
1093837510 12:23852943-23852965 AAAGAGGCAGAGAAGGAAAGGGG + Intronic
1094352370 12:29541362-29541384 AAGGAAACACAGCTAGTAAGTGG - Intronic
1094440604 12:30471670-30471692 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1097745972 12:63303417-63303439 AAGGTTGCACAGATAATAAGTGG - Intergenic
1098032957 12:66273153-66273175 AAGGAGGCACATCCAGTAAGGGG + Intergenic
1098616795 12:72536343-72536365 AAGGAGCCAGAGAAGGTAGGGGG + Intronic
1098824437 12:75275712-75275734 AAGGAGGCAGAGTTGATGAGGGG + Intergenic
1099470408 12:83041052-83041074 AAGGGGGCACAGATGAGAAAAGG - Intronic
1099871719 12:88358013-88358035 AAGGAGGAAGAGAAGGAAAGGGG - Intergenic
1100379378 12:94047415-94047437 AATGTAGCACAGTTGGTAAGGGG - Intergenic
1100708054 12:97223092-97223114 AAGGACACACAGCTTGTAAGTGG + Intergenic
1101631184 12:106496484-106496506 AAGGCCACACAGCTGGTAAGAGG - Intronic
1101796327 12:107977992-107978014 AAGGTCGCACAGCTAGTAAGTGG + Intergenic
1101840486 12:108324340-108324362 AAGGTCACACAGCTGGTAAGCGG - Intronic
1102152422 12:110698006-110698028 AAGGCCACACAGCTGGTAAGAGG + Intronic
1102198688 12:111042515-111042537 AAGGTCACACAGCTGGTAAGTGG - Intronic
1102338907 12:112106585-112106607 GAGGTCACACAGATGGTAAGTGG - Intronic
1102498316 12:113334567-113334589 AAGGCCACACAGATAGTAAGTGG - Exonic
1102633971 12:114306397-114306419 ATGGTTGCACAGCTGGTAAGCGG + Intergenic
1102717440 12:114986453-114986475 AGGGAGGAACAGAGGGAAAGAGG - Intergenic
1102748260 12:115269049-115269071 AGGGAGGCAAGGAAGGTAAGTGG + Intergenic
1103038218 12:117673441-117673463 AAGGATGGACAGATGGAAAGAGG + Intronic
1103968055 12:124652639-124652661 AAGGAGGGAGAGATTGTAAGTGG + Intergenic
1104682526 12:130761472-130761494 AGGGAGGCACAGATGAGACGTGG - Intergenic
1105064803 12:133187194-133187216 AAGGCGGCACAGGTGAAAAGTGG - Intronic
1105421517 13:20256508-20256530 AATTAGTCACAAATGGTAAGTGG - Intergenic
1106062491 13:26308349-26308371 AAAGATGCACATGTGGTAAGAGG - Intronic
1106679368 13:31994311-31994333 AAGGTGGCACAGATGCAAAGAGG + Intergenic
1107360334 13:39610865-39610887 AAGGAGACAGAGATGGAGAGAGG + Intergenic
1107645890 13:42493946-42493968 AAGGACACACAGCTAGTAAGTGG - Intergenic
1107671684 13:42752826-42752848 AAGGTGGCACAGTTCATAAGTGG + Intergenic
1107990837 13:45817875-45817897 AAAGGGGCACAGCAGGTAAGAGG - Intronic
1108318181 13:49258892-49258914 AAAGACCCACAGATGGTAAAAGG - Intronic
1108577240 13:51801015-51801037 AAGATGGCACAGCTAGTAAGAGG - Intronic
1110519354 13:76456948-76456970 AAACAGGCACAGAGGGTAAGTGG + Intergenic
1110735517 13:78931607-78931629 ATGGAGGAACAGCTGGTAGGTGG - Intergenic
1110883505 13:80603007-80603029 AAGGAGGTATAGTTGATAAGGGG - Intergenic
1112383958 13:98920480-98920502 AAGGTTACACAGTTGGTAAGTGG + Intronic
1113374496 13:109751690-109751712 AAGGAGGCACTAATGATAAGAGG + Intergenic
1114263928 14:21060072-21060094 AAGGAGGCAGAGATAGCATGGGG - Intronic
1114655384 14:24312458-24312480 AGGGAGGATCAGATGGTCAGGGG - Intronic
1115067367 14:29280537-29280559 AATGAAGAACAGATGATAAGTGG - Intergenic
1115445793 14:33488042-33488064 AAGGAGGCAGAGCAGGTAAGGGG + Intronic
1115515163 14:34177775-34177797 AAGGATGCAAAGATGGAATGTGG + Intronic
1115846423 14:37540602-37540624 AAGGAGGGAAAGATGGGGAGGGG - Intronic
1116825799 14:49672410-49672432 AAGGAGGAGCAGATGGTCAGCGG - Intronic
1117372442 14:55090874-55090896 GAGGAGACACAGAGGGTAGGTGG + Intergenic
1118105406 14:62653504-62653526 AATGAAGCTCAGAGGGTAAGTGG + Intergenic
1118372577 14:65150220-65150242 TAGGAGGGAAAGATGGGAAGAGG - Intergenic
1119784011 14:77298941-77298963 AAGGTCGCACAGCTAGTAAGTGG - Intronic
1120682359 14:87495588-87495610 CAGGAGGCTGAGATGGTGAGAGG - Intergenic
1121101936 14:91255242-91255264 AAGGATGGACAGTGGGTAAGAGG + Intergenic
1121484985 14:94307645-94307667 AAGGAGGAAGAGATGGCAAATGG + Intronic
1122498703 14:102178962-102178984 AAGGCTACACAGCTGGTAAGTGG + Intronic
1123041825 14:105493393-105493415 AAGGTGGCACAGAGGGTCACAGG - Intronic
1123125295 14:105941662-105941684 AAGGAGGCACTGATGGGCACGGG + Intergenic
1123427724 15:20185615-20185637 ATGGAGGGACAGATGGGGAGGGG - Intergenic
1123536961 15:21192165-21192187 ATGGAGGGACAGATGGGGAGGGG - Intergenic
1123579507 15:21703635-21703657 GAGCAGGCTCAGATGGGAAGTGG + Intergenic
1123616134 15:22146146-22146168 GAGCAGGCTCAGATGGGAAGTGG + Intergenic
1124320331 15:28707177-28707199 ATGGGGGCACAGATAGGAAGGGG + Intronic
1124482184 15:30088239-30088261 ATGGGGGCACAGATAGGAAGGGG - Intronic
1124488643 15:30140341-30140363 ATGGGGGCACAGATAGGAAGGGG - Intronic
1124521401 15:30408967-30408989 ATGGGGGCACAGATAGGAAGGGG + Intronic
1124537261 15:30557250-30557272 ATGGGGGCACAGATAGGAAGGGG - Intronic
1124543726 15:30609305-30609327 ATGGGGGCACAGATAGGAAGGGG - Intronic
1124754887 15:32397982-32398004 ATGGGGGCACAGATAGGAAGGGG + Intronic
1124761393 15:32450337-32450359 ATGGGGGCACAGATAGGAAGGGG + Intronic
1124777241 15:32598726-32598748 ATGGGGGCACAGATAGGAAGGGG - Intronic
1124943358 15:34239123-34239145 ATGGAGGCAGAGAAGGTAAAAGG - Exonic
1125187188 15:36944509-36944531 AAAGAGGCAGAGATGCCAAGGGG - Intronic
1125758070 15:42079124-42079146 AAGGACACACAGCTAGTAAGAGG + Intronic
1126670472 15:51111073-51111095 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1126907636 15:53384745-53384767 CAGGTGGGACAGATGGTTAGAGG + Intergenic
1127704988 15:61537577-61537599 AAAGAGGCACAGGAGGGAAGGGG + Intergenic
1127712256 15:61611176-61611198 AAGAAGGCACAGATGGCCATGGG + Intergenic
1127773672 15:62249783-62249805 GTGGGGGCACAGATGGAAAGGGG + Intergenic
1128559980 15:68658372-68658394 AAGGAGGCACAGATGGCAGGCGG - Intronic
1129001620 15:72340027-72340049 AGGCAGACACAGATGGGAAGGGG - Intronic
1129421808 15:75434009-75434031 AAGGTTGCACAGCTAGTAAGAGG + Intronic
1129596736 15:76970634-76970656 AAGGAGGTACAGATGGAAGAAGG + Intergenic
1130680244 15:85990201-85990223 AAGGACGCACAAGTGGTTAGTGG - Intergenic
1130775864 15:86981859-86981881 CAAGAGGCACAGAGAGTAAGTGG + Intronic
1131295163 15:91141498-91141520 AAAGTCTCACAGATGGTAAGTGG - Intronic
1202988377 15_KI270727v1_random:437880-437902 GAGCAGGCTCAGATGGGAAGTGG + Intergenic
1132539888 16:503891-503913 AAGGGGTCACAGAAGGTGAGGGG - Intronic
1132631705 16:920833-920855 AACGAGGGACAGATGGAGAGAGG + Intronic
1133110981 16:3548282-3548304 AAGGAGGCTCTGATGGCAGGAGG + Intronic
1133114624 16:3570066-3570088 AAGGATACACAGCTGGGAAGTGG + Intronic
1133242243 16:4421830-4421852 AAGGACACACAGCTGGTAAGTGG + Intronic
1133603058 16:7358744-7358766 AAGTAGTCACAGGTGGTAGGTGG + Intronic
1133897889 16:9946553-9946575 AAGGAAGAACAGATGCTCAGTGG - Intronic
1134013400 16:10871691-10871713 AAGGAAGCCCAGAAGGTGAGAGG - Intergenic
1134129415 16:11639133-11639155 ATGGATGCATAGATGGTCAGAGG + Intergenic
1135132356 16:19863430-19863452 AAGGTCACACAGCTGGTAAGGGG + Intronic
1136005020 16:27323509-27323531 AAGGATGCACAGCTAGTGAGTGG - Intronic
1136068159 16:27772336-27772358 AAGGCTGCACAGGTGGGAAGGGG + Intronic
1137070819 16:35903366-35903388 AGGAAGGCAAAGATGGCAAGAGG - Intergenic
1137315116 16:47310844-47310866 AAAGTCACACAGATGGTAAGTGG + Intronic
1137483257 16:48870110-48870132 AAATAGGCACAGATGGTAGGTGG + Intergenic
1137775824 16:51053528-51053550 GAAGAGGCAAAGATGCTAAGGGG - Intergenic
1138157793 16:54722045-54722067 AAGGTGACACAGCTAGTAAGTGG + Intergenic
1138585973 16:57970735-57970757 AGGGAGGCTCAGGTGGGAAGGGG + Intronic
1138752595 16:59441922-59441944 AAGGACACACAGCTGGTATGTGG + Intergenic
1139317148 16:66082608-66082630 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1139547378 16:67656053-67656075 AAGCTGGCTCAGATGGTAAGTGG + Exonic
1139710475 16:68772036-68772058 AAGGTGGCATAGTTGATAAGTGG + Intronic
1140113901 16:72025529-72025551 ACGGAGGCACCGATGGTGATAGG - Intronic
1140139870 16:72245382-72245404 AAGGTGGTACAGCTGGTAAATGG + Intergenic
1140203948 16:72918224-72918246 CAGGGGGCAAGGATGGTAAGGGG + Intronic
1140574677 16:76152737-76152759 ATGGAGGAACAGAAGGTCAGTGG + Intergenic
1140623176 16:76761232-76761254 AAGGAGGGAGAGATGATAACAGG + Intergenic
1140798635 16:78464364-78464386 AAGGAGGCACAGAGGTAGAGAGG + Intronic
1140828599 16:78730300-78730322 AAGGAGGCAGAGAGGGAAGGAGG - Intronic
1141410061 16:83827102-83827124 AAGGTAGCACAGCTGGTAAGAGG + Intergenic
1141764529 16:86049743-86049765 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1142618541 17:1151058-1151080 AAGGTCACACAGCTGGTAAGGGG - Intronic
1143311130 17:5990211-5990233 AAGGAAGTAGAGATGGAAAGAGG - Intronic
1144677005 17:17168235-17168257 AAGGAGGCAAGGCTGGCAAGGGG - Intronic
1145018200 17:19412361-19412383 ATGGAGGCACTGATGGAAATTGG + Intronic
1145258025 17:21338156-21338178 AAGGTTACACAGCTGGTAAGAGG - Intergenic
1145318614 17:21749850-21749872 AAGGTTACACAGCTGGTAAGAGG + Intergenic
1147305101 17:39557865-39557887 AAGGTAGCACAGCTGGTAAGTGG - Intronic
1148467026 17:47871354-47871376 AAGTGGGGACAGATAGTAAGAGG - Intergenic
1148862198 17:50610211-50610233 GAGGAGGCACAGGAGGGAAGAGG - Intronic
1149414326 17:56443173-56443195 AAGGCCACACAGATGATAAGAGG - Intronic
1149454247 17:56774879-56774901 AAGATTGCACAGATGGTAAGTGG - Intergenic
1149766660 17:59284415-59284437 GAGGAGGCAGAGATGGGAAGGGG + Intergenic
1150471529 17:65441578-65441600 AAAGACACACAGCTGGTAAGGGG + Intergenic
1151041274 17:70863207-70863229 ATGGAGGCATAGATGGGTAGAGG + Intergenic
1151428079 17:74044093-74044115 AAGGCTGCACAGCTGGCAAGGGG - Intergenic
1151749171 17:76027093-76027115 CAGCAGGCACAGCCGGTAAGTGG - Exonic
1151778728 17:76227569-76227591 AAGGTCACACAGATAGTAAGAGG + Intronic
1151935195 17:77257084-77257106 AAGGAGGCCCATAGGGTATGAGG + Intergenic
1152083083 17:78200595-78200617 ACGGAGGCAGAGACGGGAAGAGG + Intronic
1152684747 17:81688448-81688470 AGGGAGAGACAGATGGTCAGGGG + Intronic
1153583134 18:6595605-6595627 AAGGTAACACAGATGGTAAATGG + Intergenic
1153720380 18:7895637-7895659 AAGAAGGCACAGAAGGTCATGGG - Intronic
1155247740 18:23925955-23925977 AAGGTCACACAGCTGGTAAGTGG - Intronic
1155825644 18:30439341-30439363 AGGGAGGAACAGATGGAATGAGG - Intergenic
1156032449 18:32728311-32728333 AAGGTCACACAGATGGTAAATGG - Intronic
1156078231 18:33306068-33306090 AAGCAGGCAGAGAAGGAAAGAGG - Intronic
1156461390 18:37323224-37323246 AAGGAGGCACAGGTAGCCAGAGG + Intronic
1156481728 18:37440553-37440575 AGGGAGGCACAGAGGAGAAGTGG + Intronic
1156677267 18:39543005-39543027 GAGGAAGCACAGATGTTAGGAGG + Intergenic
1157176581 18:45457771-45457793 AAGGACACACAGGTAGTAAGTGG - Intronic
1157301044 18:46479516-46479538 AAGGTCACACAGATGGTAGGTGG - Intronic
1157327699 18:46680801-46680823 AGGGAGGCTCAGAAGGGAAGTGG + Intronic
1157544272 18:48537092-48537114 AATGAGGCATAAATGCTAAGAGG + Intergenic
1158402286 18:57131938-57131960 AATGAGAGACAGATGGGAAGAGG - Intergenic
1158960889 18:62586990-62587012 AAGAAGGCACAGACGCTAAGTGG + Intronic
1159523759 18:69561223-69561245 AAGGTTGCACAGCTAGTAAGTGG + Intronic
1159532385 18:69670950-69670972 AGGGAGGCAAAGATGGGAATTGG - Intronic
1160013002 18:75120686-75120708 ACGGAGGCAGGAATGGTAAGCGG + Intergenic
1160125369 18:76166859-76166881 AAGGAGGCTCAGATGAAGAGGGG - Intergenic
1160614845 18:80117636-80117658 AAGGAGTTACTGAAGGTAAGAGG + Exonic
1160639171 19:112905-112927 AAGGAGAGTCAGATGATAAGAGG + Intergenic
1161108074 19:2454549-2454571 AAGGTCACACAGAGGGTAAGTGG + Intronic
1162828173 19:13267214-13267236 AGGGAGAGACAGATCGTAAGTGG + Intronic
1164407315 19:27962399-27962421 AAGGAATCACAGAGGGTAAATGG + Intergenic
1166287169 19:41838353-41838375 AGGGAGGCACAGATTGTGACAGG - Intronic
1166293499 19:41877990-41878012 AAGGAGGAAGAGATGGGGAGAGG - Intronic
1166627117 19:44367831-44367853 AAGGAGGCATAGATTATAAAGGG + Intronic
1166713032 19:44949131-44949153 GAGAAAGCACAGATGGTTAGAGG - Intronic
1167368564 19:49067179-49067201 GAGAAGGTACAGATGGTGAGAGG - Intergenic
1168183801 19:54683875-54683897 AAGGAGACAGAGATAGCAAGAGG + Intronic
925173792 2:1768384-1768406 AAGGTGGCGCAGCTGGTAAATGG + Intergenic
926315853 2:11709004-11709026 AAGACCACACAGATGGTAAGTGG + Intronic
926712395 2:15891712-15891734 TAGGAGGCCCAGATGATAGGAGG - Intergenic
927333038 2:21888737-21888759 AAGGTGACACAGTTGATAAGTGG + Intergenic
927899316 2:26807937-26807959 AAGGCAGCACAGAAGGCAAGGGG - Intergenic
928604139 2:32928408-32928430 AGGGAGGAAAAGATGGTAAAAGG + Intergenic
928623254 2:33112745-33112767 AAGGAGGTACAGGTAGTAGGAGG + Intronic
929088406 2:38191265-38191287 GAGGAGGCACAGAGGAAAAGAGG + Intergenic
929654596 2:43717720-43717742 AAGGTCACACAGGTGGTAAGTGG - Intronic
929667608 2:43845363-43845385 AAGGTCACACAGCTGGTAAGTGG - Intronic
930501087 2:52218468-52218490 CGAGAGGCACAGATGGTAAGAGG - Intergenic
931121375 2:59223966-59223988 CAGAATTCACAGATGGTAAGTGG - Intergenic
931133361 2:59365876-59365898 AAGGTTAAACAGATGGTAAGTGG + Intergenic
931214670 2:60229742-60229764 TTGGAGGCACAGAAGGCAAGAGG - Intergenic
931283094 2:60810680-60810702 CAGGAGGCACAGATCGTTGGGGG - Intergenic
932285684 2:70529819-70529841 AAGGAGGCACAAGTGGGAACTGG + Intronic
932946686 2:76241801-76241823 TCTGAGGCACTGATGGTAAGGGG + Intergenic
933234579 2:79850662-79850684 AAGGTCAAACAGATGGTAAGTGG - Intronic
933699465 2:85244192-85244214 AAGGAGGCACAGTCAGAAAGGGG + Intronic
934675431 2:96246537-96246559 AAGAAGGCAGAGCTGGTGAGTGG + Intergenic
935068379 2:99672614-99672636 AAAGAGGTACAGATAGTTAGTGG + Intronic
935418086 2:102839844-102839866 AGGGAAGCACAGAAGGTTAGAGG + Intronic
935419478 2:102852702-102852724 AAGGAGACACAGCTTGGAAGTGG - Intergenic
935671901 2:105563064-105563086 AAGGTCACACAGATAGTAAGTGG + Intergenic
935981434 2:108631931-108631953 AAGGAGGCATATATGCAAAGCGG - Intronic
936507137 2:113116691-113116713 CAGGAGGGACAGATTGTAGGTGG + Intronic
937115076 2:119399175-119399197 CAAGATGCACAGTTGGTAAGGGG + Intergenic
937818170 2:126276297-126276319 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818181 2:126276329-126276351 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818192 2:126276361-126276383 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818203 2:126276393-126276415 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
939399401 2:141671376-141671398 AAGGAGGCAAAGTAGGGAAGGGG + Intronic
939799828 2:146695607-146695629 AAGGAAGCAGATGTGGTAAGAGG + Intergenic
940958180 2:159752877-159752899 AAGGACACACAGCTGGTAAATGG - Intronic
941021719 2:160414058-160414080 AATGTGACACAGATGGTAAATGG - Intronic
941617081 2:167733009-167733031 AAGGTTACACAGCTGGTAAGTGG + Intergenic
942034881 2:172001092-172001114 AAGGTCGCATAAATGGTAAGAGG + Intronic
942386136 2:175445110-175445132 AAGGTCACACAGCTGGTAAGTGG - Intergenic
942605358 2:177684810-177684832 AAGGTTTCACAGATGGTGAGTGG + Intronic
942849962 2:180472778-180472800 AAGGAGGCAGGGAAGGTGAGAGG - Intergenic
943273120 2:185832984-185833006 AAGGTGGCCCAGCTGGTAATAGG - Intronic
943345440 2:186733122-186733144 AAAGTCTCACAGATGGTAAGAGG - Intronic
945443403 2:209907522-209907544 AAGGATGCATAGATGTTAATTGG + Intronic
945452144 2:210005885-210005907 AACAAGGCAAAGATGGTAAGAGG - Intronic
945498626 2:210540702-210540724 AAGGTCACACAAATGGTAAGTGG + Intronic
945541613 2:211094445-211094467 AAGGAGGAATAGATGCTAGGAGG - Intergenic
946660296 2:221992311-221992333 AAGGAGCCAGAGTTGGTGAGTGG - Intergenic
947443654 2:230145473-230145495 AAGGAGTCACAGGTGGGTAGGGG + Intergenic
948146359 2:235711018-235711040 AAGGAGCCACAGTGAGTAAGTGG + Intronic
1169226100 20:3857963-3857985 AAAGGGACACAGCTGGTAAGTGG - Intronic
1170742972 20:19073858-19073880 AGGGAGGCAGGGATGGGAAGAGG + Intergenic
1171070189 20:22061144-22061166 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1171938775 20:31303595-31303617 GAGGAGGGAGAGATGGTAAATGG - Intronic
1172038045 20:32024090-32024112 AAGGTCACACAGCTGGTAAGTGG + Intronic
1172132823 20:32667100-32667122 CAGCAGCCACAGATGGTCAGTGG + Intergenic
1172161535 20:32872233-32872255 AAGGTCACACAGCTGGTAAGTGG - Intronic
1172805581 20:37609427-37609449 AAGGAGGCACAGAGGGTGAAGGG - Intergenic
1172899418 20:38323585-38323607 AAGGTCACACAGCTGGTAAGTGG - Intronic
1172966728 20:38840769-38840791 AAGGATGCACAGCTAGTAAACGG - Intronic
1173362528 20:42357369-42357391 AAGGAGGCAAAGATCGTATCTGG + Intronic
1173532403 20:43780465-43780487 AAGGACACACAGCTGGAAAGTGG + Intergenic
1173999358 20:47363031-47363053 AAGGCCGCACAGCTGGCAAGTGG - Intergenic
1174345256 20:49924347-49924369 AAGGTCACACAGATGGAAAGCGG - Intergenic
1174427373 20:50441714-50441736 AAGCAGGCAGAGAAGGAAAGGGG + Intergenic
1174428649 20:50451435-50451457 ACCGAGCCACAGCTGGTAAGGGG + Intergenic
1174580455 20:51567809-51567831 AAGGTTGCACAGCCGGTAAGTGG - Intergenic
1174802673 20:53577596-53577618 AAGGGTGCACAGATAGTAAGTGG + Intronic
1175126152 20:56753175-56753197 AAGGTCACACAGACGGTAAGTGG - Intergenic
1175157492 20:56981405-56981427 AAGGAGGCAGAGAGGGTGGGAGG - Intergenic
1175194350 20:57232151-57232173 AAGGTCACACAGCTGGTAAGTGG - Intronic
1175419422 20:58822017-58822039 AGGGATGCACAGACGTTAAGTGG + Intergenic
1175422819 20:58846025-58846047 CAGCAGGGACAGAGGGTAAGTGG + Intronic
1175681710 20:60994152-60994174 AAGGGCACACAGGTGGTAAGTGG - Intergenic
1175939376 20:62531055-62531077 AAGGAGTCACAGAGAGAAAGTGG + Intergenic
1176938440 21:14894619-14894641 AAGGTCCCACAGATAGTAAGTGG - Intergenic
1178449167 21:32677562-32677584 ATGTAGGCACAGGTGGAAAGAGG + Intronic
1178802401 21:35808218-35808240 AAGGTGACACAGCTGGGAAGTGG + Intronic
1179567499 21:42258370-42258392 ATGGAGGGAGAGATGGAAAGAGG - Intronic
1179680913 21:43020777-43020799 CAGGAGGCACAGGTGGGAACAGG + Intronic
1179722687 21:43324559-43324581 ACAGAGGCACAGATGGGGAGAGG - Intergenic
1180620344 22:17157847-17157869 AAGGGCACACAGCTGGTAAGTGG - Intronic
1180627749 22:17205544-17205566 AAGGACACACAGCTGGTAAATGG - Intronic
1181056183 22:20261519-20261541 AGGGAGGCTCAGAGGGTAGGTGG + Intronic
1181403978 22:22668846-22668868 AAGGTGACACAGATGGCAAGGGG - Intergenic
1181423671 22:22819135-22819157 AAGGAGGCTCAGAAGGAGAGCGG - Intronic
1181747017 22:24962509-24962531 AAGGCCACACAGCTGGTAAGCGG - Intronic
1181892095 22:26072290-26072312 AAGGATGCAAAGCTGGTAAATGG + Intergenic
1181915441 22:26276035-26276057 GAGGTGTCACAGCTGGTAAGTGG - Intronic
1181986518 22:26803696-26803718 AAGGAAGGAAAGATGGAAAGAGG - Intergenic
1182402066 22:30086144-30086166 AAGGAGGAAGAGAGGGAAAGGGG - Intronic
1182642942 22:31782981-31783003 CAGGAGGCAAAGGTGGTGAGAGG + Intronic
1182658339 22:31907103-31907125 AAGTGGTCACAGATGGTGAGAGG + Intergenic
1183037848 22:35153611-35153633 AATGAGGGACAGAGAGTAAGAGG + Intergenic
1183773800 22:39949236-39949258 AAGGAGGCATTGATGATAATTGG - Intronic
1184128786 22:42505008-42505030 AAGGAGGCACAGTTGGCTGGTGG - Intergenic
1184137581 22:42558323-42558345 AAGGAGGCACAGTTGGCTGGTGG - Intronic
1184384292 22:44165558-44165580 AAGGATGCACAGCTGGGGAGAGG - Intronic
1184611142 22:45604238-45604260 AAGGACACACAGCTAGTAAGTGG - Intergenic
1184936137 22:47723447-47723469 AGGGATGCACAGATGTTAAATGG + Intergenic
949553704 3:5133830-5133852 GGGGAGGCATAGGTGGTAAGGGG + Intronic
949840928 3:8319098-8319120 AAGGAGGCCAAGAAGGAAAGAGG - Intergenic
949867944 3:8562226-8562248 AAGGAGCCCCAGATGGAAAGAGG + Intronic
950359481 3:12440437-12440459 AAGGTTGCACAGATAGTATGCGG - Intergenic
950569160 3:13789350-13789372 AAGGAGGCAGGGAGGGGAAGGGG - Intergenic
950713927 3:14834282-14834304 AAGGACACACAGCTAGTAAGTGG - Intronic
950836547 3:15925153-15925175 ATGCAGGCACAGAGGTTAAGTGG + Intergenic
951426622 3:22553386-22553408 AGGGAGAGTCAGATGGTAAGAGG + Intergenic
951871252 3:27364984-27365006 AAGGTCCCACAGCTGGTAAGTGG + Intronic
952322867 3:32294531-32294553 AAGGATCCAGAGATAGTAAGTGG - Intronic
953211875 3:40883042-40883064 ATGGAGGAACAGCTGGTGAGTGG + Intergenic
953414305 3:42706902-42706924 AAGGCCACACAGCTGGTAAGTGG + Intronic
953493273 3:43366925-43366947 AAGGAGGAACCAATGGAAAGCGG - Exonic
953588725 3:44230769-44230791 AAAGAGCAAGAGATGGTAAGCGG + Intergenic
953861741 3:46550168-46550190 AAGTTCACACAGATGGTAAGTGG - Intronic
955106954 3:55907697-55907719 AAGGTCACACAGCTGGTAAGTGG - Intronic
955231693 3:57105073-57105095 AAGGCCGCACAGCTAGTAAGTGG - Intronic
955641857 3:61094327-61094349 AAGGTTGCACAGACAGTAAGTGG - Intronic
956059984 3:65339641-65339663 AAGGAGGCAGAGATGAGAGGAGG - Intergenic
956350039 3:68324498-68324520 AAGGAGTCACAGAAGGTGTGTGG + Intronic
956387450 3:68735206-68735228 AAGGAGGCAGCAATGGTATGGGG + Intronic
956763855 3:72467415-72467437 AAGGAGGTACAGCTAGTGAGTGG + Intergenic
957620738 3:82590539-82590561 AAGGCCACACAAATGGTAAGTGG + Intergenic
958770705 3:98422088-98422110 GGGGAGGAACAGATGGTAGGTGG - Intergenic
959625238 3:108442321-108442343 AAAGAAGCACAGATGGAGAGAGG + Intronic
959758560 3:109928823-109928845 AAGGAGGGAGAGAGGGCAAGAGG + Intergenic
962072651 3:132047596-132047618 AAGGAGGCACAGCTAGTAAGTGG + Intronic
962789993 3:138802452-138802474 AAGGAGGGAAAGAGGGCAAGAGG + Intronic
962829183 3:139124546-139124568 AAGGTCCCACAGCTGGTAAGTGG - Intronic
962890058 3:139663686-139663708 AGGGAGGCCCAGATGCTCAGAGG - Intronic
962926831 3:140001737-140001759 AAGGAGGTACGGATGGTTAATGG - Intronic
962967130 3:140365622-140365644 AAGGCCACACAGATGGTAAATGG + Intronic
964159607 3:153630999-153631021 AAGGTCACACAGCTGGTAAGTGG - Intergenic
964546849 3:157843751-157843773 AAGGAGGCAGAGAGGTTAATGGG - Intergenic
964827055 3:160840111-160840133 CAGTAGGAACAAATGGTAAGTGG + Intronic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965355309 3:167666176-167666198 AAGGAGGTAGGGATGGTTAGTGG - Intergenic
965727988 3:171739779-171739801 AAGGTCACACAGCTGGTAAGTGG + Intronic
966238745 3:177731128-177731150 AAGGCCACACAGATGGTGAGTGG + Intergenic
967823990 3:193864034-193864056 CAGGAGGGACTGATGGTAATTGG - Intergenic
967887301 3:194341912-194341934 AGGGAGGCAAAGATGGAGAGCGG + Exonic
969235180 4:5860502-5860524 AAGGAGACACAGCTGGGAAGTGG - Intronic
969444872 4:7239071-7239093 AAGGAGCCACAGAGGCCAAGAGG - Intronic
970005527 4:11407350-11407372 AAGGAAGCACAGAAGGCTAGAGG - Intronic
970212561 4:13725636-13725658 AATGTGGCACAGCTGCTAAGAGG - Intergenic
970261457 4:14229320-14229342 AAAGAGTCACAGCTGGTGAGGGG + Intergenic
970424706 4:15935301-15935323 AGGGACTCATAGATGGTAAGAGG - Intergenic
971187552 4:24395082-24395104 AAGGTGCCACAGCTGGTGAGTGG - Intergenic
971330723 4:25679169-25679191 CTGGAGGGTCAGATGGTAAGTGG - Intergenic
972228380 4:37041674-37041696 AAGGAGGAATAGATGGTAGGGGG - Intergenic
972324052 4:37998516-37998538 AAGGAGGCCCGGTTGGTCAGGGG - Intronic
972369538 4:38409646-38409668 AAGGTTTCACAAATGGTAAGTGG - Intergenic
972509567 4:39755211-39755233 ATGGAAGCACAAATAGTAAGTGG - Intronic
972587167 4:40448632-40448654 GAGGAGACACAGCTAGTAAGTGG - Intronic
972886111 4:43490987-43491009 AAGGACACACAGCTGCTAAGTGG - Intergenic
973343704 4:49031667-49031689 CAGGAGGCAGAGATGATAGGTGG + Intronic
973555482 4:52077353-52077375 AAGGAGGAAGAGATGGAGAGAGG - Intronic
973585598 4:52387782-52387804 CAGGAGGCAGAGATGGTTGGGGG - Intergenic
973639826 4:52891866-52891888 AAGGAGGGAGAGAAGCTAAGAGG - Intronic
974498724 4:62667992-62668014 AATGAGGCACTGATTCTAAGTGG + Intergenic
975166388 4:71182577-71182599 AAGGAGGAACAGCTTTTAAGTGG + Intergenic
975299017 4:72767505-72767527 AAGGTCACACAGATGGAAAGTGG - Intergenic
975709548 4:77146615-77146637 TAGGAGGTAGAGATGGTAAGGGG - Intergenic
975840347 4:78467203-78467225 AAGGGGGCAGAGATGGTTAATGG - Intronic
975924811 4:79436380-79436402 AAGGATGCACAGTTAATAAGTGG + Intergenic
976113408 4:81701066-81701088 AAGGACACACAGTTAGTAAGTGG - Intronic
978144516 4:105355976-105355998 AAAGAGGCACATATAGTAAGGGG + Intergenic
978728565 4:111999029-111999051 AAGGAGGAAAGGATGGTGAGAGG + Intergenic
979023565 4:115536974-115536996 AAAGAGACACAGAGAGTAAGAGG + Intergenic
979590016 4:122467806-122467828 AAGGAGGGATAGATATTAAGAGG - Intergenic
980791629 4:137628271-137628293 ATGGAGGCTCAGATGAAAAGAGG + Intergenic
981035844 4:140168061-140168083 CAGGGGGCACAGATGAGAAGAGG + Intergenic
981216296 4:142172891-142172913 AAGGATGCACACATTGAAAGTGG + Intronic
981767787 4:148271643-148271665 AAGGGGACAGAGATGGAAAGAGG - Intronic
982159953 4:152558508-152558530 AAGGAGGCCCATGTGGAAAGAGG - Intergenic
983071382 4:163271721-163271743 AAGGTTACACACATGGTAAGTGG + Intergenic
984925768 4:184805519-184805541 TTGGTGGCACAGATGGTGAGTGG - Intronic
986077786 5:4356093-4356115 AAGAAGGCATAAATGGAAAGAGG + Intergenic
986663655 5:10081371-10081393 AAGGTAGCATAGCTGGTAAGTGG - Intergenic
986744180 5:10730069-10730091 AAGAAAGCACAGAAGGCAAGGGG - Intronic
987135522 5:14896371-14896393 AAGGTCACACAGCTGGTAAGAGG - Intergenic
987906486 5:24084064-24084086 AAGGAGGCACACATGGTAACTGG - Intronic
990277520 5:54214082-54214104 AAGGAGGAAGAGATGGAAGGGGG + Intronic
991617664 5:68513837-68513859 AAGGTCACACAGCTGGTAAGTGG - Intergenic
992193573 5:74317540-74317562 AAGGTCGCACAGCTAGTAAGTGG + Intergenic
992340053 5:75814386-75814408 GAGGAGGAACAGGTGGTAGGTGG + Intergenic
992871170 5:81007040-81007062 AATGAGGTACAGATGGTTAATGG - Intronic
993195778 5:84743590-84743612 AAGGAGGCAGAGATGATTAATGG - Intergenic
993450703 5:88069680-88069702 AAGGAGGCTCCCATGGAAAGTGG + Intergenic
994491029 5:100444356-100444378 AAGGAGGCTAACATGGTAACAGG - Intergenic
994687182 5:102969961-102969983 GAGGAAGCACAGATGATAGGTGG + Intronic
995088819 5:108147440-108147462 TGGGAGGCAGAGATGGTGAGAGG + Intronic
995612722 5:113927201-113927223 AAGGAGCCACTGAGGGTATGTGG + Intergenic
995651622 5:114376237-114376259 AAGTAGCCACAGAAGGAAAGGGG + Intronic
997779822 5:136645229-136645251 AAGGAGGCACAGCAGAAAAGAGG + Intergenic
998087446 5:139338074-139338096 AAGGATACACAGACAGTAAGTGG - Intergenic
998405101 5:141869740-141869762 AAGGAGGAAAAGAAGGAAAGAGG - Intronic
998664023 5:144275272-144275294 AAGGAGGAGCAGATGGGAGGTGG - Intronic
999323621 5:150629850-150629872 AAGGTCGCACACCTGGTAAGTGG + Intronic
999407777 5:151322562-151322584 AGGGAGACACAGATGATAAGTGG + Intronic
1000105506 5:158055264-158055286 TGGGAGGCAAAGATGGTGAGAGG + Intergenic
1000221659 5:159220209-159220231 AAGGTCACACAGCTGGTAAGAGG - Intergenic
1000473198 5:161671940-161671962 AAGGACTCACAGCTAGTAAGTGG + Intronic
1000762544 5:165244187-165244209 AAGGAAGCAGAGAAGGGAAGGGG + Intergenic
1000888348 5:166774070-166774092 AAGGAGACATAAAAGGTAAGAGG - Intergenic
1001309528 5:170600989-170601011 AAGGTCACACAGCTGGTAAGTGG - Intronic
1001421822 5:171593411-171593433 ACTGAGGCATAGCTGGTAAGTGG - Intergenic
1001970396 5:175950678-175950700 AAGGTTGCAAAGATGGTAAGTGG + Intronic
1002247041 5:177893083-177893105 AAGGTTGCAAAGATGGTAAGTGG - Intergenic
1002358438 5:178649993-178650015 GGGGAGGCACAGGTGGCAAGTGG + Intergenic
1002746522 6:61310-61332 AAGGAGAGTCAGATGATAAGAGG + Intergenic
1003880292 6:10474492-10474514 AAGGAGACACACACAGTAAGTGG - Intergenic
1004170852 6:13294537-13294559 AAAGTCACACAGATGGTAAGTGG + Intronic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1006305236 6:33214618-33214640 AAGGTGGCTCAGTTTGTAAGTGG - Intergenic
1006588731 6:35138615-35138637 AGGGAAGCACAGATGGTTAATGG + Intronic
1006816848 6:36857272-36857294 AAGGAGAAATAGCTGGTAAGTGG + Intronic
1007816632 6:44529644-44529666 AAGGGTGCAAAGATGGGAAGAGG - Intergenic
1008374756 6:50778807-50778829 AATGGGGCACAGATGGGAAGTGG - Intergenic
1008743443 6:54638731-54638753 AATGAGGCACAGATTTTAAAAGG + Intergenic
1010538345 6:77059829-77059851 AAGGAGGAAGAGAAGGGAAGTGG - Intergenic
1012313993 6:97762395-97762417 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1012536092 6:100298685-100298707 CAGGAGGCAGAGGTGGTGAGCGG + Intergenic
1013313172 6:108916673-108916695 GAGGTGGCACAGATGGAAAGAGG + Intronic
1014514738 6:122365206-122365228 AAGCAGGCACAGATACTAACGGG - Intergenic
1014634505 6:123828645-123828667 AGGGAGGCACAAAAGTTAAGTGG - Intronic
1015158967 6:130130067-130130089 AAGGAGGCAGAGTTGGTACTAGG + Intronic
1015367555 6:132413992-132414014 AAGGTGGAATAGCTGGTAAGTGG - Intergenic
1015571244 6:134623506-134623528 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1015573166 6:134643119-134643141 CAGGAGGCACATATGGCTAGTGG - Intergenic
1017035841 6:150266476-150266498 AAGGTGGCACAGCTGGAAAATGG - Intergenic
1019549266 7:1594078-1594100 AGGGAGGGAGAGATGGAAAGAGG - Intergenic
1019859204 7:3641882-3641904 AAGGGGTCACAGATGGAAACAGG - Intronic
1020764341 7:12301844-12301866 AAGCAGGCATAGCTGGAAAGTGG - Intergenic
1021431369 7:20562110-20562132 AAGGCTCCACAGAGGGTAAGGGG - Intergenic
1022219372 7:28297344-28297366 AAGGACACACAGACAGTAAGTGG + Intergenic
1022229164 7:28396859-28396881 AAGGAGGAAGAGAAGGTAAAGGG - Intronic
1022387775 7:29917631-29917653 GCTGAGGCACAGATTGTAAGAGG - Intergenic
1023003037 7:35830839-35830861 AAGCAGAAACAGATGGAAAGAGG - Intronic
1023736761 7:43242320-43242342 GAGGAGGCAGAAATGGTGAGAGG + Intronic
1024243107 7:47450561-47450583 AGGGAGGCAGAGATGCTAAGGGG - Intronic
1026237749 7:68543228-68543250 TAGGAGTTACAGATGGCAAGAGG + Intergenic
1027251954 7:76404411-76404433 AAGGAAGCAGAGATGCTAATTGG - Exonic
1028435788 7:90802010-90802032 GAGTGGGCACAGATGGGAAGAGG + Intronic
1028807714 7:95047754-95047776 TATGAGGCACAGATGTAAAGGGG + Intronic
1029789800 7:102830315-102830337 AAGCAGGCACAGATGGAGACTGG - Intronic
1030561070 7:111086710-111086732 AATGAGTCACTGATGGTGAGGGG - Intronic
1031153753 7:118085160-118085182 AGGGAGGTCCAGATGGTAGGTGG - Intergenic
1032165180 7:129539748-129539770 CAGGAGGCAGAGGCGGTAAGAGG - Intergenic
1033215144 7:139487813-139487835 AAGGAGGAACTGATTGCAAGTGG + Intergenic
1033274247 7:139959337-139959359 AATGCGGCACAGATGTTAAAAGG + Intronic
1033996864 7:147360883-147360905 AAGGGGTCAGAGAAGGTAAGTGG + Intronic
1034016524 7:147593506-147593528 AAGGTTAAACAGATGGTAAGTGG - Intronic
1034140854 7:148814611-148814633 AAGTTGGCACAGATTGTAAGAGG - Intronic
1036080036 8:5545133-5545155 ACAGAGGCACAGATGGGGAGTGG - Intergenic
1037436017 8:18864262-18864284 AAGGTCACACAGATGGTAAGTGG - Intronic
1038529247 8:28304260-28304282 AAGGTCCCACAGATGGGAAGTGG - Intergenic
1038959397 8:32502225-32502247 CAGGAGCAACAGAGGGTAAGGGG + Intronic
1039236781 8:35510546-35510568 CATGAGGCAGAGGTGGTAAGAGG - Intronic
1039250180 8:35654956-35654978 AATGATGCACAGATGGAAAGTGG + Intronic
1040062405 8:43115203-43115225 GAGGAGGCAGAGCTGGCAAGAGG - Intronic
1040907720 8:52486037-52486059 AAGGTTGCACAGCTGGTGAGTGG - Intergenic
1040949894 8:52927042-52927064 AAGGTTGCACAGCTAGTAAGTGG + Intergenic
1041694415 8:60720716-60720738 AAGGAGCCACTGCTGGTAAGCGG - Intronic
1041754200 8:61295466-61295488 AAGGAGGAAAAGATGGCAACTGG + Intronic
1041858911 8:62488879-62488901 AAGGATACACAGGTGCTAAGTGG - Intronic
1042127535 8:65553717-65553739 AAAGAGGCACAGAGGTTAAATGG - Intergenic
1042412331 8:68479749-68479771 AAGGAGGAAGAGATGGGTAGAGG + Intronic
1042839298 8:73107806-73107828 AAGGAGGGAGAGAGGGAAAGAGG - Intronic
1043856919 8:85274837-85274859 AGGGAGCCAAAGATGGCAAGAGG - Intronic
1043882078 8:85555410-85555432 AAGAGGACACAGATAGTAAGTGG + Intergenic
1044032485 8:87255734-87255756 AAGGCCACACAGATGGTAACTGG - Intronic
1044384228 8:91568131-91568153 AAGGTCACATAGATGGTAAGTGG + Intergenic
1044492279 8:92833678-92833700 AAGGAGTCAAAGATGGTAATGGG + Intergenic
1044891681 8:96842795-96842817 AATGAGGCACATCTGGCAAGTGG - Intronic
1044941421 8:97347883-97347905 AAGGAAGCACAGAGTGAAAGCGG - Intergenic
1045226543 8:100252265-100252287 AAGGAGGCAGAGAAGAGAAGGGG + Intronic
1045595761 8:103653488-103653510 AAGGAAGCACAGAGGCTAAGTGG - Intronic
1045754508 8:105526920-105526942 AAGGTCTCACAGATGGTAAATGG - Intronic
1046098938 8:109592534-109592556 AAGGAGGCCAAGAGGGTCAGAGG + Intronic
1046110495 8:109717526-109717548 AAGGACTCACAGCTAGTAAGTGG - Intergenic
1046171759 8:110517348-110517370 AAGAACACACAGATGGTAAGTGG - Intergenic
1046363921 8:113200355-113200377 AAGGAGGCAAAAATGGAAATAGG - Intronic
1046710485 8:117505762-117505784 GAGCAGGCATAGAAGGTAAGGGG - Intergenic
1048283420 8:133122555-133122577 AAGGCCACACAGATAGTAAGTGG - Intronic
1048583500 8:135750567-135750589 AAGGTGGCTCAGTAGGTAAGGGG + Intergenic
1049018193 8:139936404-139936426 AATCAGGCACAAATGGTGAGTGG + Intronic
1049082950 8:140457285-140457307 TCGGAGGCACAGAGGGGAAGGGG + Intronic
1049158045 8:141078827-141078849 CAGGGGGCACAGGTGGTTAGTGG + Intergenic
1049680021 8:143913962-143913984 AAGGAAGCACAGGTTGTCAGTGG - Intergenic
1051529586 9:18085273-18085295 AAGATCGCACAGCTGGTAAGTGG - Intergenic
1051707149 9:19892795-19892817 AAGGTCACACAGATGGTAAGTGG + Intergenic
1051793223 9:20832665-20832687 AGGGAGGCAGGGATGGTTAGTGG - Intronic
1052987746 9:34500638-34500660 AAGGAGGTACAGACAGTAAGTGG + Intronic
1053056534 9:34996333-34996355 AAGGAGGCAAAGGTGGCATGGGG - Exonic
1053135568 9:35648506-35648528 AAGAACACACAGCTGGTAAGTGG + Intergenic
1055140441 9:72871183-72871205 AAGGGGCCACATCTGGTAAGTGG + Intergenic
1055676383 9:78666504-78666526 AAGGATGCATGGATAGTAAGTGG - Intergenic
1056193794 9:84209818-84209840 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1056205537 9:84316160-84316182 AGGGAGGCAGAGATGGACAGAGG + Intronic
1056411040 9:86327484-86327506 AAGGACACACAGCTGGGAAGTGG + Intronic
1057695202 9:97318271-97318293 AAGGAGGGACAGAGGGTGGGTGG - Intronic
1058425645 9:104873618-104873640 AAGAAAGCACAGCTGGCAAGGGG - Intronic
1058836104 9:108859708-108859730 GAAGAGGCACAGAGGGTAACAGG + Intergenic
1058913070 9:109539008-109539030 AAGGAACCACAGATAATAAGTGG + Intergenic
1059376756 9:113888094-113888116 AAGGCTACACAGCTGGTAAGTGG + Intronic
1059721668 9:116965861-116965883 TAGGAAGCACAGATGGTAAAGGG - Intronic
1059798294 9:117723922-117723944 AAGCATTCACATATGGTAAGAGG - Intergenic
1059974626 9:119702250-119702272 AAGGAAACACAGCTAGTAAGTGG - Intergenic
1059999365 9:119944307-119944329 AAGGAGGTACTCATGGTTAGGGG - Intergenic
1060000681 9:119955798-119955820 AAGGAGACACAGCTAGTAAGTGG + Intergenic
1060533650 9:124365294-124365316 AAGGAGCCACAGATGGACACGGG + Intronic
1060578176 9:124717775-124717797 AAGGTCACACAGCTGGTAAGTGG - Intronic
1061059759 9:128244607-128244629 GAGGAGGCACAGATGGATGGGGG - Intronic
1061648531 9:132026919-132026941 ATTGAGGCACAGACGTTAAGCGG + Intronic
1061704314 9:132441045-132441067 AAGGAGGAAAAGAGAGTAAGAGG - Intronic
1062447812 9:136603008-136603030 GAGGAGTCACAGATGATAAGTGG - Intergenic
1186201776 X:7162585-7162607 ACGGAGGCACTGTTGGTACGTGG + Intergenic
1186490766 X:9970421-9970443 AAGGAGGGAGAGATGGAGAGAGG - Intergenic
1187227870 X:17391304-17391326 AAGGTCACACAGCTGGTAAGTGG - Intronic
1187406058 X:19005066-19005088 AAGGACACACAGATAGAAAGTGG + Intronic
1187497240 X:19805758-19805780 AAGGGAGCACAGATTGTAAATGG - Intronic
1187888974 X:23915536-23915558 AAGGCTACACAGATAGTAAGTGG + Intronic
1188178613 X:27025254-27025276 AAGGAAGCCCATATGGCAAGTGG + Intergenic
1188537393 X:31212768-31212790 ATGGAGGTACATATTGTAAGGGG + Intronic
1189090062 X:38072698-38072720 AAGGAGCCAGAGATGCTAAATGG + Intronic
1189617337 X:42797133-42797155 AAGGAGGCAGAGATGAGAAGGGG - Intergenic
1189716973 X:43877157-43877179 AAGGTGGCACAGCTAGTTAGTGG + Intronic
1189795230 X:44639611-44639633 AAGAGCACACAGATGGTAAGTGG + Intergenic
1190485022 X:50915470-50915492 AAGGACACACAGCTGGTATGTGG - Intronic
1192130347 X:68543782-68543804 AAGGCCGCACAGCTAGTAAGTGG + Intergenic
1192682133 X:73263149-73263171 AAGGGGCCAGAGATGATAAGGGG - Intergenic
1193022064 X:76801633-76801655 AAGCAGGCACAGGTACTAAGAGG - Intergenic
1193421012 X:81281956-81281978 AAGGAGGCACATAAAGTAAAGGG + Intronic
1193931076 X:87552826-87552848 GGGGAGGTACAGATGGTTAGTGG + Intronic
1196014056 X:110918602-110918624 AAGGATGCAAAGCTGGGAAGTGG - Intergenic
1196187390 X:112759076-112759098 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1196739407 X:119011293-119011315 AAGGAGGCACAGCTGAAAGGAGG - Intronic
1196774697 X:119327621-119327643 AAGGCCACACAGCTGGTAAGTGG - Intergenic
1197829697 X:130628277-130628299 AAGGTCACACAGCTGGTAAGTGG + Intronic
1197899962 X:131360088-131360110 AAGGTCACACAGATGATAAGTGG + Intronic
1198385156 X:136122245-136122267 CAGGAGTCACAGATGCAAAGGGG - Intergenic
1198732079 X:139742349-139742371 AAGGACACACAGCTAGTAAGTGG + Intronic
1200335970 X:155351852-155351874 CAGGAGAGACAGAAGGTAAGGGG - Intergenic
1200350500 X:155489375-155489397 CAGGAGAGACAGAAGGTAAGGGG + Intergenic
1202233524 Y:22681815-22681837 AAGGAGGGACAGAGGGAGAGGGG - Intergenic
1202309632 Y:23514343-23514365 AAGGAGGGACAGAGGGAGAGGGG + Intergenic
1202561169 Y:26156249-26156271 AAGGAGGGACAGAGGGAGAGGGG - Intergenic