ID: 923409110

View in Genome Browser
Species Human (GRCh38)
Location 1:233689968-233689990
Sequence AGGTTTGCCCAGAACTATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923409110_923409114 2 Left 923409110 1:233689968-233689990 CCAGGATAGTTCTGGGCAAACCT No data
Right 923409114 1:233689993-233690015 ATAGTCGGTTGCCCTAATTAGGG No data
923409110_923409118 18 Left 923409110 1:233689968-233689990 CCAGGATAGTTCTGGGCAAACCT No data
Right 923409118 1:233690009-233690031 ATTAGGGGTCACAGCAAGACTGG No data
923409110_923409113 1 Left 923409110 1:233689968-233689990 CCAGGATAGTTCTGGGCAAACCT No data
Right 923409113 1:233689992-233690014 AATAGTCGGTTGCCCTAATTAGG No data
923409110_923409115 3 Left 923409110 1:233689968-233689990 CCAGGATAGTTCTGGGCAAACCT No data
Right 923409115 1:233689994-233690016 TAGTCGGTTGCCCTAATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923409110 Original CRISPR AGGTTTGCCCAGAACTATCC TGG (reversed) Intergenic
No off target data available for this crispr