ID: 923412719

View in Genome Browser
Species Human (GRCh38)
Location 1:233725822-233725844
Sequence GCAAACTGGTAAAAGGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 13, 1: 24, 2: 27, 3: 29, 4: 174}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923412719_923412733 28 Left 923412719 1:233725822-233725844 CCCAAGGCCTTTTACCAGTTTGC 0: 13
1: 24
2: 27
3: 29
4: 174
Right 923412733 1:233725873-233725895 TGGGAGCATGTCAGGTTTCTGGG No data
923412719_923412729 20 Left 923412719 1:233725822-233725844 CCCAAGGCCTTTTACCAGTTTGC 0: 13
1: 24
2: 27
3: 29
4: 174
Right 923412729 1:233725865-233725887 GGCCCGTTTGGGAGCATGTCAGG No data
923412719_923412732 27 Left 923412719 1:233725822-233725844 CCCAAGGCCTTTTACCAGTTTGC 0: 13
1: 24
2: 27
3: 29
4: 174
Right 923412732 1:233725872-233725894 TTGGGAGCATGTCAGGTTTCTGG No data
923412719_923412727 9 Left 923412719 1:233725822-233725844 CCCAAGGCCTTTTACCAGTTTGC 0: 13
1: 24
2: 27
3: 29
4: 174
Right 923412727 1:233725854-233725876 GAGAAGCCAAAGGCCCGTTTGGG No data
923412719_923412726 8 Left 923412719 1:233725822-233725844 CCCAAGGCCTTTTACCAGTTTGC 0: 13
1: 24
2: 27
3: 29
4: 174
Right 923412726 1:233725853-233725875 AGAGAAGCCAAAGGCCCGTTTGG No data
923412719_923412725 -1 Left 923412719 1:233725822-233725844 CCCAAGGCCTTTTACCAGTTTGC 0: 13
1: 24
2: 27
3: 29
4: 174
Right 923412725 1:233725844-233725866 CACAGGGAAAGAGAAGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923412719 Original CRISPR GCAAACTGGTAAAAGGCCTT GGG (reversed) Intergenic
900846359 1:5105083-5105105 GCAAGCTGATAAAAAGCCCTGGG - Intergenic
906433138 1:45772419-45772441 GCAAACTGTTATAAGGGCTATGG - Intergenic
906956145 1:50376359-50376381 GCAAACTAGTAAAAGCACTATGG + Intergenic
907379982 1:54078950-54078972 GCCAACTAGCAAAACGCCTTTGG + Intronic
909736733 1:78970967-78970989 GCAAACTGGTAAAAGGCCTTGGG + Intronic
909909795 1:81246594-81246616 GAAAAGTGGTAAAAGGGGTTGGG - Intergenic
910626502 1:89313471-89313493 ATAAGCTGGTAAAAGGCCTCAGG - Intergenic
910940517 1:92528245-92528267 GTAAACTGGTATAAGCACTTTGG + Intronic
911709015 1:101047859-101047881 GTAAAATGGTGAAAGGACTTTGG + Intergenic
912861097 1:113214638-113214660 GCACACTGGTGCAAGGCCTTGGG + Intergenic
913030444 1:114897418-114897440 GCAAACTGGTAAAAGGCCTTGGG - Intronic
913539267 1:119803341-119803363 TCACACTGGTAAAAGGCCATAGG - Intronic
914397029 1:147279461-147279483 TCAAACTGAGAAAAGGCCTTCGG + Intronic
915824039 1:159056663-159056685 GCAAACTGATAAAAGGCCTCAGG - Intergenic
916071471 1:161172543-161172565 GCCAACTGTTTAAAGGCCCTAGG - Intronic
916118035 1:161504837-161504859 GCAAACTGCTCTAATGCCTTTGG + Intergenic
916165568 1:161964367-161964389 GCAAGCTGGGAAGAGGCCTTTGG - Intergenic
917210008 1:172621697-172621719 GCAAAATGGTAAAAGGCCTCGGG + Intergenic
917391049 1:174537472-174537494 GGATATTGGTAAAAGGTCTTGGG + Intronic
917627417 1:176860145-176860167 CCTAAGTCGTAAAAGGCCTTAGG - Intronic
917716738 1:177745843-177745865 GCATAATGGTATAATGCCTTTGG + Intergenic
917721490 1:177790638-177790660 ACAAACTGGGAAGAGGACTTAGG + Intergenic
917746756 1:178017070-178017092 GCAAAATGGTACAAGCACTTTGG + Intergenic
917999865 1:180482993-180483015 GTAAACTTGTAAAAAGACTTAGG - Intronic
918174987 1:182035773-182035795 GCAAACTGGTAAAAGGCCTTAGG - Intergenic
918979366 1:191535491-191535513 GTAAAGTGGTAAAACGACTTTGG + Intergenic
920151899 1:203916936-203916958 GTAAACTGGTAAAACCACTTTGG - Intergenic
923412719 1:233725822-233725844 GCAAACTGGTAAAAGGCCTTGGG - Intergenic
923913911 1:238481766-238481788 GCAAACTGGTAAAAGGCCTCGGG - Intergenic
924454320 1:244206433-244206455 GCAGACTGGCAAAGGGCCCTTGG - Intergenic
1063306905 10:4910857-4910879 GCAAACCAGTAAAAGGCCTCAGG + Intergenic
1063812671 10:9731720-9731742 GCAAACTGGTTAGGGGCCTTGGG + Intergenic
1063856149 10:10256506-10256528 GCAAACTGATGAAAGTACTTTGG - Intergenic
1064175561 10:13072091-13072113 GCAAACCAGTAAAAGGCCTTGGG + Intronic
1064482963 10:15757933-15757955 GCAAAATGGTACAACCCCTTTGG - Intergenic
1065318708 10:24488809-24488831 GCATCCTGGAAAAATGCCTTCGG + Intronic
1066710778 10:38231093-38231115 GCAAACTGGTGAAAGGCCTTGGG + Intergenic
1066979238 10:42396362-42396384 GCAAACTGGTGAAAAGCCTTGGG - Intergenic
1067734006 10:48834932-48834954 GCAAACTGTTAAAAGCCACTTGG - Intronic
1072482691 10:95824823-95824845 GCAAAATGGAACAAGGTCTTTGG + Intronic
1073066000 10:100759540-100759562 GCAACCTGGTCAAAGGCTCTGGG - Intronic
1075475594 10:122730915-122730937 GCAGGCTGGTGAGAGGCCTTGGG - Intergenic
1075570953 10:123544973-123544995 GCAAATTGGAACAATGCCTTTGG + Intergenic
1075866989 10:125731701-125731723 GCAAAATGGTACAATGCCTCTGG - Intronic
1077350599 11:2091450-2091472 GCCAGCTGGGAAAAGGGCTTGGG - Intergenic
1077475100 11:2783591-2783613 GCAAAATGGTATAAATCCTTTGG - Intronic
1084879898 11:72163461-72163483 GCAAACTGGTAAAAGGCCTAGGG - Intergenic
1085566656 11:77520464-77520486 GCAAACAGGTAAAAGGCCTCAGG - Intronic
1085946365 11:81277919-81277941 GCAAACTGGTAAAAGGCCTTGGG + Intergenic
1088215278 11:107500950-107500972 GCAAACTGGTAGAGGCACTTAGG + Intergenic
1088802870 11:113322552-113322574 GCAAACTGTTAAAAGTCATTGGG + Intronic
1092012559 12:5126986-5127008 TCACCCTGGTAAAAGGCCATGGG + Intergenic
1092563103 12:9637204-9637226 GTGAACTGGTAAAAGGCCTCAGG - Intergenic
1092723881 12:11466727-11466749 GAAAAGTGGGAAAAGGCATTGGG + Intronic
1093921976 12:24869194-24869216 GTAAACTGGTATAAGCACTTTGG + Intronic
1096262202 12:50099893-50099915 CCAAACGGGTAAAAAGCCCTGGG + Exonic
1097844445 12:64352160-64352182 GCAAACAAGTAAAAGACCTCAGG + Intronic
1099426651 12:82531869-82531891 GTATACAGGTAAAAGGCATTTGG + Intergenic
1099922447 12:88976029-88976051 GCAAAATGGTACAATGCCTATGG - Intergenic
1101775464 12:107789311-107789333 GCAAACAAGTAAAAGGCCTTGGG - Intergenic
1105321146 13:19323603-19323625 GCAGAGTTGTCAAAGGCCTTGGG - Intergenic
1108204240 13:48072041-48072063 GCAAACTGGTAAAAGGCCTCGGG + Intronic
1108297027 13:49032194-49032216 GTAAACTGGTAAATGTACTTTGG + Intronic
1108764551 13:53611029-53611051 GAAAACTGGCAAAAGATCTTGGG - Intergenic
1109013024 13:56974670-56974692 GCAAACTGGCAAAAGGTCTTGGG + Intergenic
1112082779 13:95993034-95993056 GCAAACTGGAAAAAGACAATGGG + Intronic
1113549029 13:111177374-111177396 GCAAACTGGTCAAGGCCCATTGG + Intronic
1114205022 14:20562233-20562255 GCAAAATTTTAAAAGGACTTAGG + Intergenic
1117775837 14:59183373-59183395 GTAAACTGGTAAAACTGCTTTGG - Intergenic
1120992477 14:90390022-90390044 GCAAACTGTTGAAAGGCATTGGG + Intergenic
1122255456 14:100472697-100472719 GCAGACTGGGAGGAGGCCTTGGG + Intronic
1124468336 15:29960821-29960843 GTAAACTGTTAAAAGGCATATGG + Intronic
1124861554 15:33447069-33447091 GCAAAGTTGAAAACGGCCTTTGG - Intronic
1125082275 15:35688996-35689018 GCAAAATGGTACAAGCACTTTGG - Intergenic
1125433476 15:39622073-39622095 GCAATCTGGAAAAAGGCTGTGGG - Intronic
1126338030 15:47607850-47607872 GCAGACAGGCAAAAGGCCTAGGG + Intronic
1126484352 15:49163073-49163095 GCAAAATGGTAAAACCACTTAGG - Intronic
1126905856 15:53364311-53364333 GCAAATTGGTAAAAAGCCAATGG + Intergenic
1127277487 15:57460229-57460251 GACAACTGGGAAAAGGCCATCGG + Intronic
1131440221 15:92454280-92454302 GCATACAGGTAGAAGGCCATGGG - Intronic
1132099079 15:99010111-99010133 TCAAACTGGTCAAATTCCTTTGG + Intergenic
1135885036 16:26298052-26298074 GCAGACTGTTAAAAGGACTCTGG - Intergenic
1137282993 16:46993719-46993741 GCAAAATGGTACAAACCCTTTGG + Intergenic
1138241877 16:55434041-55434063 ACACATTGGTAAAAGGCCTGTGG + Intronic
1139774443 16:69306980-69307002 GCAAACTGAGAAAGGGACTTAGG - Exonic
1143533879 17:7524068-7524090 GCAAACCAGTAAAAGGCCTCAGG - Intergenic
1143680897 17:8475258-8475280 GCAAACTGTGAAAGGGGCTTTGG - Exonic
1144228355 17:13173883-13173905 GCCAGTTGGTAAAAGGTCTTGGG + Intergenic
1146697665 17:34922347-34922369 GCAAACTGGTATAAACCCTATGG + Intergenic
1148253471 17:46106996-46107018 GCAAACTAGTTAAAGGCCCCAGG + Intronic
1149407214 17:56365575-56365597 GCAACGTGGTAAAAGGGCTTTGG - Intronic
1150197110 17:63311033-63311055 TCAGATTGGTAAAAGACCTTAGG + Intronic
1151149618 17:72073735-72073757 GCAAGGTCATAAAAGGCCTTGGG + Intergenic
1152003805 17:77664347-77664369 GCCAGCTGGTAGAAGCCCTTGGG + Intergenic
1154043494 18:10882311-10882333 GGTAACTGGAGAAAGGCCTTGGG - Intronic
1156698446 18:39795754-39795776 GCAAACTGGTAAAAGGCCTCGGG - Intergenic
1156893899 18:42221622-42221644 GCAAAATGGTACAAGTACTTTGG - Intergenic
1156971946 18:43167194-43167216 ACAAACTGGCAAAAGTCCTTGGG + Intergenic
1156972245 18:43170561-43170583 GCAAAGTGATATAAGGCCTCTGG + Intergenic
1157823065 18:50788037-50788059 GCAAACTGGGACAAGGCCAGTGG - Intergenic
1158151839 18:54382708-54382730 GCTAACTGGTAAAAAGCCTTGGG - Intronic
1158641406 18:59207028-59207050 GCAAACTGGTAAAAGGCCTTGGG + Intergenic
1158968968 18:62648592-62648614 ATAAACTGGTAATAGCCCTTAGG + Intergenic
1168571322 19:57473273-57473295 TCACACTGGAGAAAGGCCTTAGG - Exonic
1168585785 19:57590591-57590613 CCATACTGGAGAAAGGCCTTGGG + Exonic
929288188 2:40159857-40159879 GCAGACTGGAAAAAGGGATTTGG + Intronic
929727498 2:44445726-44445748 GCAAACTGGTAAAAGGCCTCAGG + Intronic
932959874 2:76400268-76400290 GGAATCTCATAAAAGGCCTTGGG + Intergenic
934865080 2:97801245-97801267 GCAAACTGGTCCAAGCCTTTTGG - Intronic
934932139 2:98435278-98435300 GCAAACTGGTAAAAGGCCTCAGG + Intergenic
935009112 2:99114436-99114458 ACAAAATGGAAATAGGCCTTTGG - Intronic
937324389 2:120981580-120981602 GGAAACAGATAAAAGGCGTTTGG + Intronic
937727615 2:125186290-125186312 GCAAACTGGTAAAAGGCCTCAGG - Intergenic
940494121 2:154403695-154403717 GCAACCTGGTATTAGGCCTGGGG - Intronic
940847378 2:158656554-158656576 GAAAAGGGGTAAAAGTCCTTGGG + Intronic
941249872 2:163148330-163148352 GCAAACTGGTAAAAAGCTTCAGG + Intergenic
941800602 2:169655506-169655528 GCAAACTGTTAAAAGTGTTTTGG + Intronic
942432174 2:175923722-175923744 GCAAACTGATAAAGGGCAATTGG + Intergenic
943420087 2:187658892-187658914 GCAAACTAGTAAAAGAACTCAGG + Intergenic
944291170 2:198006858-198006880 AGAAACTGGTAAAAGGTTTTGGG - Intronic
945309195 2:208290701-208290723 GCAAAATGGTAAAACCACTTTGG - Intronic
945943688 2:215974039-215974061 GCATATTGGTAAAAGAGCTTGGG + Intronic
946297189 2:218794526-218794548 GCAAACTGGTAAAAGGCCTTGGG - Intronic
947371336 2:229449685-229449707 GCAAACTGGTACCCAGCCTTGGG - Intronic
1169963177 20:11185572-11185594 GCAAACTGGTACAACCACTTTGG - Intergenic
1170067117 20:12324469-12324491 GCAAATTGGTAAAACTACTTTGG + Intergenic
1170222283 20:13953200-13953222 GCAAACTGGTAAAAGGCCTTGGG + Intronic
1174312627 20:49669874-49669896 GCAGACTGGTATAAACCCTTTGG + Intronic
1177543090 21:22520802-22520824 GCAAGCTGGTAAAAGGCCTCAGG + Intergenic
1178566932 21:33695156-33695178 GCAAACTGTTACAACTCCTTTGG - Intronic
1181411828 22:22728621-22728643 GTAAGCTGGTAAAATGTCTTTGG + Intergenic
1181848251 22:25730514-25730536 CCAAACTGGTAAAAGTGCCTAGG - Intergenic
1182596731 22:31427071-31427093 GTAATCTGGTAACTGGCCTTTGG - Exonic
1183539811 22:38423475-38423497 GCAAGCTGGTGAAGGGCCTGGGG + Intergenic
949151247 3:770240-770262 GGCAACTGGCTAAAGGCCTTAGG + Intergenic
950284389 3:11733370-11733392 GCAGAAGGGTAAAAGGCCTCAGG - Intergenic
950705414 3:14776884-14776906 GCAAAATGGTAAAAGTACTTTGG + Intergenic
951638055 3:24801940-24801962 GCAAAATGGTACAAGCTCTTTGG - Intergenic
952521218 3:34159502-34159524 GGAAACTGGTAAAGGGACTGAGG + Intergenic
952637060 3:35545390-35545412 GTAAACTGGTAAAAGGCCTCAGG - Intergenic
953647516 3:44768949-44768971 GCAAACCAGTAAAAGGCCTCGGG - Intronic
955613342 3:60780458-60780480 GCAAACTGGCAAAAGGCCTCAGG + Intronic
955913458 3:63881994-63882016 GCAAACTGAGAGAAGGGCTTTGG - Intronic
956559027 3:70552905-70552927 GCAAATTGGTAAAACCACTTTGG - Intergenic
957288659 3:78249119-78249141 GCAAACTGGTAAAAGGCCTCGGG + Intergenic
958744335 3:98114242-98114264 GTAAACTGGCAAAAAGCCTTGGG + Intergenic
959995742 3:112678385-112678407 AAAAACTGGTGAAGGGCCTTGGG + Intergenic
960852590 3:122071693-122071715 GCAAAATGGTAAAACTACTTTGG - Intronic
962147860 3:132859789-132859811 GAAAATTTGTAAAAGGACTTGGG - Intergenic
963434022 3:145244942-145244964 ACACACTGGTAAAAGACCTCAGG - Intergenic
963909649 3:150805276-150805298 GCAAAATGGTAGAATGCCTATGG + Intergenic
963936138 3:151055533-151055555 GGTAACTGGAAAAAGGCCATTGG - Intergenic
964304386 3:155325217-155325239 GCAAACTGGTAAAAGGCCTCGGG + Intergenic
966466439 3:180235203-180235225 CCAAACTAGTAAAAGACTTTGGG + Intergenic
966523749 3:180899538-180899560 GCAAACTGGTAAAAGGCCTAAGG + Intronic
967531088 3:190549604-190549626 GCAAACTGGTAAAAGGCCTCAGG - Intronic
968381516 4:100704-100726 GCAAACTGGTAAAAGGCTTTGGG + Intergenic
969163867 4:5287193-5287215 GTAAACTGGTACAAACCCTTTGG - Intronic
969914909 4:10481223-10481245 AAAAACTGGTAAAGGGCCTGGGG - Intergenic
970686919 4:18578948-18578970 GCAAACTGGTAAGAGGTTTCAGG + Intergenic
972844951 4:42976260-42976282 GCAATCTGGTAAAAAGCTTGAGG + Intronic
973223903 4:47760581-47760603 GCATACTTGTTAACGGCCTTAGG + Intronic
974231796 4:59125914-59125936 TCATCCTGGTAAAAGGCCATAGG + Intergenic
974675167 4:65079403-65079425 TCAAACTGGTAAAAGGCCTCAGG + Intergenic
975756650 4:77578143-77578165 GCAAACTGGTAAAAGGCCTCAGG + Intronic
976343789 4:83975940-83975962 GTAAACTGGTATAAGCCCTTTGG - Intergenic
977427720 4:96890264-96890286 GTAAACTGGTAAAACTTCTTTGG - Intergenic
978127946 4:105157622-105157644 GCAAACTTGAAAAAGACGTTTGG + Intronic
979104636 4:116668166-116668188 GCAAACCGATAAAAGGCCTCAGG + Intergenic
979507433 4:121514317-121514339 GCAAACTGGTAAAAGGCCTTGGG + Intergenic
980722951 4:136720940-136720962 GCAAACTTATAAAAGGCCTCGGG + Intergenic
981255975 4:142660676-142660698 GCAAACTGGTAAAGGGCCTCAGG + Intronic
981324170 4:143427482-143427504 GCAAACCGATAAAAGACCTTGGG - Intronic
981456815 4:144962270-144962292 GCAAACTGGTAAAAGGTCTTGGG + Intergenic
981770696 4:148304386-148304408 ACAAACTGGTAAAAGGCCTCGGG + Intronic
983321659 4:166202830-166202852 GCAAACTGGTAAAAGCCCTCCGG + Intergenic
984327850 4:178275656-178275678 GCAAACTGGTAAAAGGCCTTGGG + Intergenic
986213785 5:5699050-5699072 GCAGACTGGTAAAAGGCCTCAGG + Intergenic
986401255 5:7383953-7383975 GCAAAGTGATAAATGGCCCTGGG + Intergenic
987607915 5:20162569-20162591 GCAGACTTGTTTAAGGCCTTTGG + Intronic
988157808 5:27477240-27477262 GCAAACTGGTAAAAGGCGTCTGG + Intergenic
991727744 5:69552838-69552860 GTAAACTGGTACAAGTACTTTGG - Intronic
991867213 5:71075036-71075058 GTAAACTGGTACAAGTACTTTGG + Intergenic
992423295 5:76628172-76628194 TCACCCTGGTAAAAGGCCATAGG - Intronic
993292631 5:86095052-86095074 GGAAACTGTAAAAAAGCCTTTGG - Intergenic
994179901 5:96752827-96752849 ACAAAAATGTAAAAGGCCTTGGG - Intronic
994625524 5:102214133-102214155 GCAAACTCATAAAAGCCCTGTGG + Intergenic
995848160 5:116516604-116516626 TCAAACTGATAAACTGCCTTTGG - Intronic
996887137 5:128370749-128370771 GCAAGCAGATAAAAGGCCTATGG + Intronic
998281038 5:140807744-140807766 ACGAGCTGGTAAAAGGTCTTGGG + Exonic
998476022 5:142422739-142422761 GCAAAGTCCTAAAAGGCCTTGGG + Intergenic
998809421 5:145951395-145951417 GTAAACTGGTAACATGACTTGGG - Intronic
999016244 5:148108941-148108963 GCAAACTGGGAAAATGTGTTTGG + Intronic
999149340 5:149416454-149416476 GCAAACTGGGAATGGGCCTTGGG + Intergenic
1000208744 5:159090108-159090130 GCAAACTGTCAACAAGCCTTTGG + Intronic
1003800608 6:9662141-9662163 GTAAACTGGTAAAATCCTTTTGG - Intronic
1003826990 6:9963859-9963881 ACAAACTGGTACAACCCCTTTGG - Intronic
1005042490 6:21611699-21611721 GCTAAGTGGTAGCAGGCCTTGGG + Intergenic
1006101469 6:31688614-31688636 GCAAGTTGGTAAAAGGCCACTGG - Intronic
1008466884 6:51841562-51841584 ACATACTGGTAAAAATCCTTGGG + Intronic
1008634532 6:53396560-53396582 GCAAACTGGGAAAGGCCTTTCGG - Intergenic
1010541704 6:77099637-77099659 GCAAATTAGTAAAAAGTCTTGGG + Intergenic
1011044148 6:83063789-83063811 GCAAACTGGTACAATCACTTTGG + Intronic
1011591176 6:88972102-88972124 GCAAACTGGTAAAAGGCCTTGGG + Intergenic
1012047507 6:94297081-94297103 GTAAACTGGAAAACAGCCTTAGG - Intergenic
1012583851 6:100899019-100899041 GCAAATTGGTAAAGGGCCTTGGG + Intergenic
1012693811 6:102353149-102353171 GCAAACTGGTAAAAGAGCCTGGG - Intergenic
1012804722 6:103879310-103879332 GCAAACTGGTAAAAGGCCTCAGG + Intergenic
1013971329 6:116023194-116023216 TCAAAATAGTACAAGGCCTTTGG + Intronic
1016233440 6:141833035-141833057 GCAAACTGGTAAAAGGCCTCGGG + Intergenic
1017343892 6:153357243-153357265 GCAAACTGGTAAAAGGCCTCAGG + Intergenic
1021648261 7:22807828-22807850 GCAAACTGATAAAAGGCCTCAGG + Intergenic
1022322155 7:29297607-29297629 GCAAACTACTAAAAGGCCTCGGG - Intronic
1022690477 7:32647005-32647027 GAAAACTGGTACAAGCACTTTGG + Intergenic
1022918024 7:34980850-34980872 GAAAACTGGTACAAGCACTTTGG + Intronic
1024398366 7:48894561-48894583 GCGAATTGGTAAAAGGCCTTGGG + Intergenic
1024474316 7:49794158-49794180 GCAAATGGGCAAAAGGGCTTTGG - Intronic
1025757914 7:64362725-64362747 GCAAACTGGTAAAAGACCTTGGG - Intergenic
1027753309 7:82179512-82179534 GCAAAGTGATTGAAGGCCTTTGG - Intronic
1030611099 7:111690155-111690177 GCATACTGGTAAAATGACATTGG + Intergenic
1031835129 7:126672701-126672723 GCAAACTGGTAAAAGGCCTTGGG + Intronic
1032242935 7:130179640-130179662 ACAAACTGGTAAAAGCTTTTTGG + Intronic
1032266893 7:130375750-130375772 GCAAACTCGTTATAGGACTTTGG - Intergenic
1033590872 7:142807166-142807188 GCAAGCTGATAAAAATCCTTTGG - Intergenic
1033730016 7:144169135-144169157 GCAACATGGTAAAAAGTCTTAGG + Intergenic
1033866147 7:145692388-145692410 GTAAACTGGTAAAAGGCCTGGGG + Intergenic
1036191141 8:6671372-6671394 GGAAACTAGAAAGAGGCCTTGGG - Intergenic
1036468113 8:9022081-9022103 GCAAACTGGTACAATTCCATTGG - Intronic
1037215486 8:16446246-16446268 ACAAACTGATAAAATACCTTTGG - Intronic
1037806813 8:22062555-22062577 GCAAACACATTAAAGGCCTTAGG + Intronic
1038557484 8:28535310-28535332 GAAAACTGGTACAAGGCATATGG - Intronic
1040064999 8:43138515-43138537 ACAAATTGGTAAAAAGCCTCAGG + Intergenic
1040758448 8:50808826-50808848 GCAAACTGGCAAAACGCCTTGGG + Intergenic
1042415038 8:68509364-68509386 GCACACTGCTAAAAGGCCTTGGG - Intronic
1045549827 8:103161707-103161729 GCAAAATGGCACAAGGCCTCTGG - Intronic
1046472648 8:114697744-114697766 GCAAAATGGTAAAACCACTTTGG + Intergenic
1048176122 8:132154257-132154279 ACAAACTGGTAAAAGCCCCTGGG + Intronic
1048693948 8:137002659-137002681 TAAAACTGAGAAAAGGCCTTTGG + Intergenic
1050929772 9:11308417-11308439 GAAAACTGGTGAAAGTCCTTGGG + Intergenic
1052059319 9:23941640-23941662 GCAAACTAGTAAAAGGCTTTAGG - Intergenic
1052504738 9:29339305-29339327 GCAAACTGGTAAACTTGCTTTGG - Intergenic
1052647704 9:31257579-31257601 GGAAAATGGTAAAATGCCATAGG - Intergenic
1055232891 9:74086820-74086842 GAAAACTGGGAAAAGGGGTTGGG - Intergenic
1056207390 9:84333700-84333722 GCAAATTGGTAAAATCACTTAGG + Intronic
1058281974 9:103127393-103127415 GCAAACTAGTAAAAAGCCTTGGG - Intergenic
1058823843 9:108757507-108757529 GAAAATTGGTAAAATGTCTTGGG - Intergenic
1185768922 X:2749775-2749797 GCACACAGGGAGAAGGCCTTGGG - Intergenic
1186427690 X:9476649-9476671 GCCAAATGGTAAAAGCCCCTGGG + Intronic
1188219052 X:27517649-27517671 TCAAACTGGTATAAGTGCTTTGG + Intergenic
1188763274 X:34057961-34057983 GCAAAGTCATAAAAGGCCTTGGG + Intergenic
1188803543 X:34560062-34560084 GCAAACGAGTAAAAGGACTCGGG - Intergenic
1189153426 X:38730468-38730490 GTAAACTGGTAAAAGCCCTCGGG + Intergenic
1190491154 X:50983674-50983696 GCAAACTGGTAAAAGGCCTCAGG + Intergenic
1191644624 X:63467053-63467075 GCCAACTGGTAAAAGGCCTCGGG - Intergenic
1193269771 X:79515515-79515537 GAAAACCGGTAAAAGTCCTCAGG + Intergenic
1193481763 X:82035920-82035942 GCAAACTGGTAAAAGGCCTCAGG + Intergenic
1194066318 X:89266709-89266731 ACAAACTGGTAAAAGGCCTTGGG - Intergenic
1194131161 X:90084079-90084101 GCAAACTGGTATAAGGCCTCAGG - Intergenic
1194809791 X:98375850-98375872 GCAAACCAGTAAAAGGGCTCAGG - Intergenic
1194846178 X:98812097-98812119 GCATCCTTGTAAAAGGGCTTGGG + Intergenic
1195578788 X:106478857-106478879 GCAAACTGATAAAAAGTCCTGGG - Intergenic
1195857439 X:109346467-109346489 GCAAACAGCTAAAAGTCATTCGG + Intergenic
1196520241 X:116663547-116663569 GCAAACTGGAAAAAGGCCTTAGG - Intergenic
1196563478 X:117177876-117177898 GCAAACTGGTAAAAGGCCTTGGG + Intergenic
1199169818 X:144722296-144722318 GCAAAATGGTAAAAGGCATCAGG + Intergenic
1200720488 Y:6600828-6600850 ACAAACTGGTAAAAGGCCTTGGG - Intergenic
1201242671 Y:11973760-11973782 GCAAGCTGGTAAAAGGGCAAGGG - Intergenic