ID: 923412720

View in Genome Browser
Species Human (GRCh38)
Location 1:233725823-233725845
Sequence TGCAAACTGGTAAAAGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 27, 1: 28, 2: 23, 3: 29, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923412720_923412732 26 Left 923412720 1:233725823-233725845 CCAAGGCCTTTTACCAGTTTGCA 0: 27
1: 28
2: 23
3: 29
4: 157
Right 923412732 1:233725872-233725894 TTGGGAGCATGTCAGGTTTCTGG No data
923412720_923412725 -2 Left 923412720 1:233725823-233725845 CCAAGGCCTTTTACCAGTTTGCA 0: 27
1: 28
2: 23
3: 29
4: 157
Right 923412725 1:233725844-233725866 CACAGGGAAAGAGAAGCCAAAGG No data
923412720_923412733 27 Left 923412720 1:233725823-233725845 CCAAGGCCTTTTACCAGTTTGCA 0: 27
1: 28
2: 23
3: 29
4: 157
Right 923412733 1:233725873-233725895 TGGGAGCATGTCAGGTTTCTGGG No data
923412720_923412727 8 Left 923412720 1:233725823-233725845 CCAAGGCCTTTTACCAGTTTGCA 0: 27
1: 28
2: 23
3: 29
4: 157
Right 923412727 1:233725854-233725876 GAGAAGCCAAAGGCCCGTTTGGG No data
923412720_923412726 7 Left 923412720 1:233725823-233725845 CCAAGGCCTTTTACCAGTTTGCA 0: 27
1: 28
2: 23
3: 29
4: 157
Right 923412726 1:233725853-233725875 AGAGAAGCCAAAGGCCCGTTTGG No data
923412720_923412729 19 Left 923412720 1:233725823-233725845 CCAAGGCCTTTTACCAGTTTGCA 0: 27
1: 28
2: 23
3: 29
4: 157
Right 923412729 1:233725865-233725887 GGCCCGTTTGGGAGCATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923412720 Original CRISPR TGCAAACTGGTAAAAGGCCT TGG (reversed) Intergenic
905055885 1:35093054-35093076 GGCAAAGAGGTAAAAGACCTCGG + Intronic
905517802 1:38574973-38574995 TGAACACTGGTAAAAGGGGTGGG - Intergenic
906809402 1:48810894-48810916 TGCTAGTTGGTAAAAGGCCCAGG + Intronic
909660510 1:78076669-78076691 TGCAGACTGGTACCAGCCCTTGG - Intronic
909736732 1:78970966-78970988 TGCAAACTGGTAAAAGGCCTTGG + Intronic
910063999 1:83130825-83130847 TGGAAAATGGCAAAAGGGCTTGG - Intergenic
912861096 1:113214637-113214659 TGCACACTGGTGCAAGGCCTTGG + Intergenic
913030445 1:114897419-114897441 TGCAAACTGGTAAAAGGCCTTGG - Intronic
913103550 1:115592257-115592279 TACAAACTGGTAAAAGGCCCTGG + Intergenic
915516170 1:156413859-156413881 TGCAAACTGGAACGGGGCCTGGG - Intronic
917210007 1:172621696-172621718 GGCAAAATGGTAAAAGGCCTCGG + Intergenic
917391048 1:174537471-174537493 TGGATATTGGTAAAAGGTCTTGG + Intronic
917895672 1:179484646-179484668 TGCACACTGGCAAATGGCATGGG - Intronic
919007746 1:191921492-191921514 TGCAGACTGGTAAGAGTCCTTGG + Intergenic
919758418 1:201080874-201080896 TGCAAACAAGTAAAATCCCTGGG - Intronic
920403215 1:205690322-205690344 TGCAAAATGGTACTATGCCTTGG - Intergenic
922365270 1:224857489-224857511 TACAAATTGGTAAAAGTCATAGG + Intergenic
922507616 1:226135669-226135691 TAGAAACTGAGAAAAGGCCTAGG + Intergenic
923412720 1:233725823-233725845 TGCAAACTGGTAAAAGGCCTTGG - Intergenic
923913912 1:238481767-238481789 TGCAAACTGGTAAAAGGCCTCGG - Intergenic
924366310 1:243297503-243297525 TGTAAACTGATAAAACCCCTTGG - Intronic
1063812670 10:9731719-9731741 GGCAAACTGGTTAGGGGCCTTGG + Intergenic
1064175560 10:13072090-13072112 TGCAAACCAGTAAAAGGCCTTGG + Intronic
1065770741 10:29075791-29075813 GCCAAACTGGTGAAAGGCCCTGG - Intergenic
1066710777 10:38231092-38231114 TGCAAACTGGTGAAAGGCCTTGG + Intergenic
1066979239 10:42396363-42396385 TGCAAACTGGTGAAAAGCCTTGG - Intergenic
1070749133 10:78953549-78953571 TGCAAACTGGGAGAAGAGCTCGG + Intergenic
1072029243 10:91502207-91502229 TGAAAACTGGTAGATAGCCTGGG - Intronic
1072815113 10:98499933-98499955 TATATAATGGTAAAAGGCCTTGG + Intronic
1075463442 10:122633592-122633614 AGCAAATTGGTGAAAGACCTAGG - Intronic
1075475595 10:122730916-122730938 TGCAGGCTGGTGAGAGGCCTTGG - Intergenic
1076499395 10:130924444-130924466 TGCAGACTTCTAAATGGCCTGGG + Intergenic
1078017515 11:7627618-7627640 TCCAAACTGAGAGAAGGCCTTGG + Intronic
1078480084 11:11667928-11667950 TGCAATCAGGGAACAGGCCTGGG + Intergenic
1078580400 11:12535240-12535262 AGCAATCTGGCAAAAGCCCTTGG - Intergenic
1078900195 11:15634872-15634894 TGCAAACGGGTGAAATGTCTTGG - Intergenic
1079149837 11:17887865-17887887 TGCAGACTGGTAAAATTCCACGG + Intronic
1081209393 11:40313203-40313225 AGCAACATGGTGAAAGGCCTGGG - Intronic
1082110529 11:48268661-48268683 TCCATACTGGTAAAAAGCCTGGG - Intergenic
1082640026 11:55648254-55648276 TGCAAAATGATAAATGACCTTGG - Intergenic
1082742188 11:56923377-56923399 TGCAAACTGGTTGACAGCCTAGG - Intergenic
1082747788 11:56984940-56984962 TGTAAACTGGTAAAAGGTCTCGG - Intergenic
1083484440 11:62974593-62974615 CCCCAACTGGTAAAAGTCCTGGG - Intronic
1084879899 11:72163462-72163484 TGCAAACTGGTAAAAGGCCTAGG - Intergenic
1085946364 11:81277918-81277940 TGCAAACTGGTAAAAGGCCTTGG + Intergenic
1086296454 11:85373206-85373228 TGCAAACTGGTAAAAGGCCTTGG + Intronic
1088802869 11:113322551-113322573 TGCAAACTGTTAAAAGTCATTGG + Intronic
1092585687 12:9899067-9899089 TGCAAACTGATAAAAGGCCTTGG - Intronic
1096483800 12:51962209-51962231 TCCAATCTGGGAAAAGGTCTTGG - Intronic
1098574193 12:72022527-72022549 TGCAAACTGGTTCAAGGTCAGGG + Intronic
1098805500 12:75016454-75016476 TGCAAACTGGTAAACGGCCTTGG - Intergenic
1098867965 12:75783996-75784018 TGCAAATATGTAAAAGTCCTGGG + Intergenic
1099534586 12:83828283-83828305 TGCAAACTGGTAAAAGGCCTTGG - Intergenic
1100756750 12:97759620-97759642 TGCAAACCTGCAAAAGTCCTGGG + Intergenic
1101775465 12:107789312-107789334 TGCAAACAAGTAAAAGGCCTTGG - Intergenic
1105381420 13:19890978-19891000 TACAAAGTAGTAAAATGCCTAGG - Intergenic
1106167434 13:27261177-27261199 TGCAAACTGGTATAACCCTTTGG - Intergenic
1108204239 13:48072040-48072062 TGCAAACTGGTAAAAGGCCTCGG + Intronic
1109013023 13:56974669-56974691 TGCAAACTGGCAAAAGGTCTTGG + Intergenic
1109745433 13:66617655-66617677 TGCAAACTGGTAAAAGGCCTCGG + Intronic
1109865784 13:68261092-68261114 TGCAAACTGGTGAAAGGCCTTGG + Intergenic
1110990567 13:82038432-82038454 TGTAAACTGGTAAAAGGCCTTGG - Intergenic
1115439219 14:33412581-33412603 TTCAAACTGGTAAATCACCTTGG - Intronic
1117186850 14:53248154-53248176 TGCCAACTGGGAAATGACCTTGG + Intergenic
1120314358 14:82872470-82872492 TGCAAATTGATAAAAGGCCTTGG + Intergenic
1120992476 14:90390021-90390043 GGCAAACTGTTGAAAGGCATTGG + Intergenic
1121270878 14:92637491-92637513 TACAAACTGGTATTAGGCCATGG - Intronic
1123497124 15:20838538-20838560 TGCAAAATAGTAAAATACCTAGG + Intronic
1123554358 15:21412172-21412194 TGCAAAATAGTAAAATACCTAGG + Intronic
1123590603 15:21849493-21849515 TGCAAAATAGTAAAATACCTAGG + Intergenic
1124150531 15:27174033-27174055 AGCAAAATGATAAGAGGCCTGGG - Intronic
1125742761 15:41978643-41978665 TGCAGAGTGGTTAAAGGCCTGGG + Intergenic
1126338029 15:47607849-47607871 TGCAGACAGGCAAAAGGCCTAGG + Intronic
1129412037 15:75355553-75355575 TGCCAGCAGGTAAAGGGCCTGGG - Exonic
1202962705 15_KI270727v1_random:139370-139392 TGCAAAATAGTAAAATACCTAGG + Intergenic
1133705489 16:8350663-8350685 TGCAAACTGTTAAGAAGTCTAGG - Intergenic
1134333579 16:13272714-13272736 TGCATACTGGTAGAATGCCTTGG + Intergenic
1139034009 16:62921079-62921101 TGCCAAATGGTAAAACTCCTTGG + Intergenic
1139223945 16:65215904-65215926 TGCAAACTGGGGAATAGCCTGGG - Intergenic
1139266258 16:65641690-65641712 TGCAAGGTTGTGAAAGGCCTGGG + Intergenic
1143477529 17:7211342-7211364 TTAAAACAAGTAAAAGGCCTGGG + Intronic
1144228354 17:13173882-13173904 TGCCAGTTGGTAAAAGGTCTTGG + Intergenic
1144645816 17:16972657-16972679 TGCATACTAGCAGAAGGCCTTGG + Intergenic
1145917084 17:28580873-28580895 TGCAGACTGGGAAAAAGACTGGG - Intronic
1156698447 18:39795755-39795777 TGCAAACTGGTAAAAGGCCTCGG - Intergenic
1156924855 18:42563893-42563915 TGCAAAATGGCAAGAGGCTTTGG + Intergenic
1156971945 18:43167193-43167215 AACAAACTGGCAAAAGTCCTTGG + Intergenic
1157625137 18:49044823-49044845 TGGAGTCTGGGAAAAGGCCTAGG + Intronic
1157912058 18:51625524-51625546 TGGAAACTGCCAAAAGACCTTGG + Intergenic
1158151840 18:54382709-54382731 TGCTAACTGGTAAAAAGCCTTGG - Intronic
1158641405 18:59207027-59207049 GGCAAACTGGTAAAAGGCCTTGG + Intergenic
1159729159 18:72003452-72003474 TGCAAATTGTTAAACTGCCTTGG + Intergenic
1162680383 19:12336163-12336185 TGGAAACTGGTAAATGGACTGGG + Intergenic
1168585783 19:57590590-57590612 TCCATACTGGAGAAAGGCCTTGG + Exonic
925455375 2:4012070-4012092 TTCTCACTGGTAAAAGGCCGTGG - Intergenic
926792799 2:16592283-16592305 CTCAAACTGGTATAAGGTCTTGG + Intronic
936840102 2:116758363-116758385 GGCCAACTGGTAAAAGGCCTTGG + Intergenic
938417366 2:131114889-131114911 TGGAAACAGGTAAAAGGCAGAGG - Intronic
940494122 2:154403696-154403718 GGCAACCTGGTATTAGGCCTGGG - Intronic
943764436 2:191645569-191645591 TGCTAACTGGGAAGAGGACTGGG + Intergenic
943906223 2:193503153-193503175 TGCAAACTGGTAAAAGCCCTAGG - Intergenic
943962696 2:194286941-194286963 TGCAAGCTGATGAAAGGACTGGG + Intergenic
944291171 2:198006859-198006881 TAGAAACTGGTAAAAGGTTTTGG - Intronic
945479027 2:210322872-210322894 TGCAAACTTGATAAAGGACTGGG + Intergenic
945849713 2:214991411-214991433 TTCAAACTGGTAAAAAACCATGG + Intronic
946297190 2:218794527-218794549 GGCAAACTGGTAAAAGGCCTTGG - Intronic
1169950657 20:11039835-11039857 TGAAAATTTGTAAAAGCCCTAGG + Intergenic
1170222282 20:13953199-13953221 TGCAAACTGGTAAAAGGCCTTGG + Intronic
1174315016 20:49692552-49692574 TGTAAACTGGTGAAAATCCTTGG + Intronic
1176199109 20:63852275-63852297 TGCAAACTGGTGCAAGGAGTTGG - Intergenic
1178610664 21:34075908-34075930 TGCACACCGGTAGCAGGCCTTGG + Intronic
1178619527 21:34161600-34161622 TGCAAACTGGTAAAATGCCTCGG - Intergenic
1179515168 21:41901228-41901250 TGCAAAAAAGTAAAAGGCTTTGG + Intronic
1183539810 22:38423474-38423496 TGCAAGCTGGTGAAGGGCCTGGG + Intergenic
1183971288 22:41479497-41479519 GGCTGACTGGTAAAAAGCCTGGG - Intronic
1184870861 22:47237776-47237798 GGCAAAATGGAAAGAGGCCTGGG - Intergenic
951017264 3:17744344-17744366 TGCAAAGTCTTTAAAGGCCTAGG - Intronic
951063246 3:18234835-18234857 GGCAAACTGGTCACAGGCCAGGG + Intronic
951345980 3:21547322-21547344 TGCAAACTGGTAAAAGGCCTTGG + Intronic
951761255 3:26149193-26149215 TATATAATGGTAAAAGGCCTTGG + Intergenic
952193378 3:31047106-31047128 TGCAAACTGGTAAAAGGTCTTGG + Intergenic
953647517 3:44768950-44768972 TGCAAACCAGTAAAAGGCCTCGG - Intronic
957028161 3:75208851-75208873 TGCAAAAGGTTAAAAGGCCTTGG + Intergenic
957288658 3:78249118-78249140 TGCAAACTGGTAAAAGGCCTCGG + Intergenic
957574581 3:81991049-81991071 TGCTAACTGGTAAAAGGCCTTGG + Intergenic
958744334 3:98114241-98114263 TGTAAACTGGCAAAAAGCCTTGG + Intergenic
959858554 3:111190197-111190219 TACACACTGGTAAAAGTCCAAGG - Intronic
960020686 3:112948669-112948691 TGCAGACTGGTACCAGTCCTTGG - Intronic
962147861 3:132859790-132859812 TGAAAATTTGTAAAAGGACTTGG - Intergenic
964304385 3:155325216-155325238 TGCAAACTGGTAAAAGGCCTCGG + Intergenic
965639271 3:170815507-170815529 CACAGACTGGTAAAAGTCCTCGG - Intronic
966466437 3:180235202-180235224 TCCAAACTAGTAAAAGACTTTGG + Intergenic
967422010 3:189283977-189283999 TACAATCTGGTAATAGGCCAAGG - Intronic
967577263 3:191108242-191108264 TGCACACTGGTACAAGGACTGGG - Intergenic
968381515 4:100703-100725 TGCAAACTGGTAAAAGGCTTTGG + Intergenic
969262769 4:6044028-6044050 TGCTAGCTTGTTAAAGGCCTGGG - Intronic
969471670 4:7392760-7392782 TGCAAACCCATAAAAGCCCTGGG + Intronic
969914910 4:10481224-10481246 TAAAAACTGGTAAAGGGCCTGGG - Intergenic
975017581 4:69442137-69442159 TGCAACCTGGTAAAAATCCTTGG + Intergenic
975424372 4:74209123-74209145 TGCAAACTGGTAAAAGGTCTAGG - Intronic
977623491 4:99164079-99164101 TGCAAAGTGGTGCAAGGGCTGGG - Intergenic
979507432 4:121514316-121514338 TGCAAACTGGTAAAAGGCCTTGG + Intergenic
980511884 4:133802396-133802418 TGTAAAATGGCAAAATGCCTAGG - Intergenic
980722950 4:136720939-136720961 TGCAAACTTATAAAAGGCCTCGG + Intergenic
980841733 4:138269721-138269743 TGTAAACTGGTAAACCTCCTTGG - Intergenic
981090256 4:140724964-140724986 TGCAACTTGGTAAAACCCCTAGG + Intronic
981324171 4:143427483-143427505 TGCAAACCGATAAAAGACCTTGG - Intronic
981456814 4:144962269-144962291 TGCAAACTGGTAAAAGGTCTTGG + Intergenic
981770695 4:148304385-148304407 TACAAACTGGTAAAAGGCCTCGG + Intronic
982560030 4:156918468-156918490 TGCAGACTGGTACCAGTCCTTGG + Intronic
984327849 4:178275655-178275677 TGCAAACTGGTAAAAGGCCTTGG + Intergenic
987658013 5:20833215-20833237 TGCAAACTAATGAAAGGCCAAGG - Intergenic
988137570 5:27193543-27193565 AGCCAACACGTAAAAGGCCTGGG + Intergenic
991274523 5:64828799-64828821 TGTAAACTGGTGAGTGGCCTGGG - Intronic
995829942 5:116344448-116344470 TGCAAACTGGTAAAAAGCCTTGG - Intronic
996575433 5:124972693-124972715 TGCAAACTGGTAAAAGGCCTTGG + Intergenic
998476021 5:142422738-142422760 AGCAAAGTCCTAAAAGGCCTTGG + Intergenic
998809422 5:145951396-145951418 TGTAAACTGGTAACATGACTTGG - Intronic
999008266 5:148006021-148006043 TACAAACTGGTAAAAGGCCTCGG + Intergenic
999149339 5:149416453-149416475 AGCAAACTGGGAATGGGCCTTGG + Intergenic
999847109 5:155495382-155495404 TGCAAATTGGTAAGAGACCCAGG - Intergenic
1001843218 5:174898486-174898508 TTCAAACTGCTAAAAAACCTTGG - Intergenic
1001981771 5:176043254-176043276 TGGGACCTGGTATAAGGCCTGGG + Intergenic
1002235694 5:177800806-177800828 TGGGACCTGGTATAAGGCCTGGG - Intergenic
1003137404 6:3444377-3444399 TGAAAACTGGAGAAAGGGCTGGG - Intronic
1005667177 6:28069823-28069845 TGCAAAATGGAAAAAGGTATTGG + Intergenic
1005667243 6:28070488-28070510 TGCAAAATGGAAGAAGGCTTTGG - Intergenic
1008466883 6:51841561-51841583 TACATACTGGTAAAAATCCTTGG + Intronic
1008949372 6:57138661-57138683 TACAAACTGGGAAAAGGAATGGG - Intronic
1009632266 6:66214386-66214408 TGCAAACTGGTAAAAATGCTTGG + Intergenic
1009907538 6:69888263-69888285 TGCAAACTGGTAAAAGGCCTTGG - Intronic
1009907845 6:69891150-69891172 TGCAAACTGGTAAAAGGCCTTGG - Intronic
1009915753 6:69993583-69993605 TACCAACTAGTAAAAGCCCTGGG - Intronic
1010276582 6:73974598-73974620 TGCAAACTGGTACAATACCTTGG - Intergenic
1010541703 6:77099636-77099658 TGCAAATTAGTAAAAAGTCTTGG + Intergenic
1010669804 6:78674393-78674415 TGCAAAGTTGTGAAAGGCCTTGG - Intergenic
1011353116 6:86445010-86445032 GGCAAACTTATAAAAGTCCTAGG - Intergenic
1011591175 6:88972101-88972123 TGCAAACTGGTAAAAGGCCTTGG + Intergenic
1012583850 6:100899018-100899040 TGCAAATTGGTAAAGGGCCTTGG + Intergenic
1012595380 6:101032286-101032308 TGCAAACTGGTAAAAGCTTTGGG + Intergenic
1012693812 6:102353150-102353172 TGCAAACTGGTAAAAGAGCCTGG - Intergenic
1013615572 6:111839945-111839967 TGAAAGCTGGGAAGAGGCCTTGG - Intronic
1016233439 6:141833034-141833056 TGCAAACTGGTAAAAGGCCTCGG + Intergenic
1017533439 6:155321076-155321098 TTCAAACTTTTAAAAGTCCTAGG + Intergenic
1018814832 6:167322864-167322886 TGCTAACTGGAAAAATGTCTAGG + Intergenic
1019118985 6:169788326-169788348 TGCAAACAGGTAAAAGGACAGGG - Intergenic
1020080660 7:5284083-5284105 TGCAAAGTGGTGAGGGGCCTTGG + Intronic
1020677271 7:11197201-11197223 TGCAAACTGGTAAAAGGCCTTGG + Intergenic
1021531072 7:21646014-21646036 TGCAAAGTGGGAAAAGGTGTTGG + Intronic
1022322156 7:29297608-29297630 TGCAAACTACTAAAAGGCCTCGG - Intronic
1023718789 7:43072074-43072096 TGCAAACTGGTAAAAGGCCTTGG - Intergenic
1024398365 7:48894560-48894582 TGCGAATTGGTAAAAGGCCTTGG + Intergenic
1024655397 7:51447609-51447631 TGCAAACTGGTAAAAGGCCTTGG + Intergenic
1025157822 7:56625315-56625337 TGCAAACTGATAAAGGACATAGG + Intergenic
1025198266 7:56948091-56948113 TGCAAAGTGGTGAGGGGCCTTGG - Intergenic
1025673683 7:63628842-63628864 TGCAAAGTGGTGAGGGGCCTTGG + Intergenic
1025757915 7:64362726-64362748 TGCAAACTGGTAAAAGACCTTGG - Intergenic
1025863498 7:65356984-65357006 TAAGAACTGGTAAAAGGCTTTGG - Intergenic
1026631252 7:72039959-72039981 TGCAAAAAGTTTAAAGGCCTGGG - Intronic
1027756609 7:82221991-82222013 TACAAACTGGTAAAAACCTTTGG - Intronic
1027850982 7:83451602-83451624 GGCAAACTGGCAAAAAGCCTGGG + Intronic
1029363959 7:100105644-100105666 TGCAAATTGGAAAAAGGCTTGGG + Intronic
1030238029 7:107288397-107288419 TCTAAACTGGTACAGGGCCTTGG - Intronic
1030245861 7:107384009-107384031 TGCAAACTGGTAGAAGGCCTCGG + Intronic
1030614154 7:111720523-111720545 TACCAACTAGAAAAAGGCCTAGG + Intergenic
1031835128 7:126672700-126672722 TGCAAACTGGTAAAAGGCCTTGG + Intronic
1033471098 7:141649899-141649921 TGGAAAAGGGAAAAAGGCCTGGG - Intronic
1033866146 7:145692387-145692409 TGTAAACTGGTAAAAGGCCTGGG + Intergenic
1034121959 7:148636435-148636457 TTCAATCTGGCAAGAGGCCTGGG - Intergenic
1034219692 7:149434162-149434184 TGCAAACTCTAGAAAGGCCTAGG - Intronic
1034270209 7:149800013-149800035 TGCACACAGGTAGAAGGGCTTGG - Intergenic
1034658867 7:152751852-152751874 TGTAAAATGATAAAAGGACTGGG + Intergenic
1034917906 7:155056211-155056233 TGCACACTGGTAAGGGGCCAGGG - Intergenic
1037111548 8:15168960-15168982 TGTAAACTGGTAAAAGGCCTGGG + Intronic
1037893871 8:22638987-22639009 TGCAAACTTGTAAATCCCCTGGG - Intronic
1040374085 8:46806273-46806295 TGTAAACTGGTAAAAGACCTTGG - Intergenic
1040722034 8:50336151-50336173 TGCAAACTGCAAAGAGGACTGGG + Intronic
1040758447 8:50808825-50808847 TGCAAACTGGCAAAACGCCTTGG + Intergenic
1040990806 8:53347546-53347568 TGAAAACTGGTAAAATGCCTTGG + Intergenic
1042415039 8:68509365-68509387 TGCACACTGCTAAAAGGCCTTGG - Intronic
1045079026 8:98604306-98604328 GGCACACTGATAAAAGGCGTGGG + Intronic
1045350303 8:101332137-101332159 TGCAAACTGGGGAAAAGACTAGG - Intergenic
1046068504 8:109223179-109223201 TGCAAACTGGTAAATGGCCTCGG + Intergenic
1047201221 8:122769595-122769617 TTCCAGCTGCTAAAAGGCCTCGG + Intergenic
1047607844 8:126492265-126492287 TGTAAAATGGAAAAAGGCATGGG + Intergenic
1048176121 8:132154256-132154278 TACAAACTGGTAAAAGCCCCTGG + Intronic
1049987518 9:965620-965642 TGCTAACTGGAAACAGGCCCAGG + Intronic
1050508629 9:6371728-6371750 TGAAAGCTGGTAAAAGGCCACGG - Intergenic
1050929771 9:11308416-11308438 TGAAAACTGGTGAAAGTCCTTGG + Intergenic
1051063104 9:13068319-13068341 TGCAAAATGGTAACAGCACTTGG + Intergenic
1051346499 9:16155519-16155541 TGCAAACTTCTCACAGGCCTTGG + Intergenic
1052122018 9:24729809-24729831 TGTATAGTGGTAAATGGCCTTGG - Intergenic
1055355404 9:75432177-75432199 TGAAAACATTTAAAAGGCCTAGG - Intergenic
1057350089 9:94289102-94289124 TTCAAACTGGTAAAATGGCCAGG + Intronic
1057960844 9:99455208-99455230 TGAAAGCTGGTACAAGGGCTGGG - Intergenic
1058165124 9:101610549-101610571 TGCAAGCTGGTCAATGCCCTTGG - Intronic
1058281975 9:103127394-103127416 TGCAAACTAGTAAAAAGCCTTGG - Intergenic
1058823844 9:108757508-108757530 TGAAAATTGGTAAAATGTCTTGG - Intergenic
1203776074 EBV:73898-73920 TGCAAAGTGGGCAAAAGCCTCGG + Intergenic
1185768923 X:2749776-2749798 TGCACACAGGGAGAAGGCCTTGG - Intergenic
1186246046 X:7618111-7618133 TGCAAACTGATTAAGGGGCTCGG + Intergenic
1187130247 X:16495545-16495567 TGCAGACTGGTGCCAGGCCTTGG - Intergenic
1188763273 X:34057960-34057982 TGCAAAGTCATAAAAGGCCTTGG + Intergenic
1188803544 X:34560063-34560085 TGCAAACGAGTAAAAGGACTCGG - Intergenic
1188862388 X:35272630-35272652 TGCAAACTGGTAAAAGCCCTTGG - Intergenic
1189153425 X:38730467-38730489 TGTAAACTGGTAAAAGCCCTCGG + Intergenic
1189616475 X:42789336-42789358 TGCAAACCAGTAAAAGGCCTTGG - Intergenic
1190226380 X:48549016-48549038 TACAAATTGGTCAAAGGTCTAGG - Intronic
1191644625 X:63467054-63467076 TGCCAACTGGTAAAAGGCCTCGG - Intergenic
1192681071 X:73254580-73254602 TGTAAACTGGTAAAAGTCCTTGG - Intergenic
1193132042 X:77930568-77930590 TGCATAGTGGTTAAAGGCATGGG + Intronic
1193945029 X:87724299-87724321 TGCAAACTGGTAAAAGGCCTTGG - Intergenic
1194066319 X:89266710-89266732 TACAAACTGGTAAAAGGCCTTGG - Intergenic
1194577871 X:95636755-95636777 AGCAAACATTTAAAAGGCCTAGG + Intergenic
1195432603 X:104806156-104806178 TGCAAACTTTTACAAGGCCCAGG - Intronic
1196563477 X:117177875-117177897 AGCAAACTGGTAAAAGGCCTTGG + Intergenic
1197064525 X:122221988-122222010 TGCAAACTGGTAAAAGTGTCAGG + Intergenic
1200720489 Y:6600829-6600851 TACAAACTGGTAAAAGGCCTTGG - Intergenic
1200898600 Y:8403888-8403910 TGCAAACTGGTAAAAGACCTAGG + Intergenic
1201242672 Y:11973761-11973783 TGCAAGCTGGTAAAAGGGCAAGG - Intergenic
1201464519 Y:14265904-14265926 TGCAAACTGATTAAGGGGCTTGG + Intergenic
1202267334 Y:23033870-23033892 TGTAAACTGGAAAAATACCTTGG - Intergenic
1202420326 Y:24667614-24667636 TGTAAACTGGAAAAATACCTTGG - Intergenic
1202450460 Y:25002468-25002490 TGTAAACTGGAAAAATACCTTGG + Intergenic