ID: 923412723

View in Genome Browser
Species Human (GRCh38)
Location 1:233725829-233725851
Sequence TCCCTGTGCAAACTGGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 39, 1: 58, 2: 56, 3: 46, 4: 310}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923412723_923412729 13 Left 923412723 1:233725829-233725851 CCTTTTACCAGTTTGCACAGGGA 0: 39
1: 58
2: 56
3: 46
4: 310
Right 923412729 1:233725865-233725887 GGCCCGTTTGGGAGCATGTCAGG No data
923412723_923412727 2 Left 923412723 1:233725829-233725851 CCTTTTACCAGTTTGCACAGGGA 0: 39
1: 58
2: 56
3: 46
4: 310
Right 923412727 1:233725854-233725876 GAGAAGCCAAAGGCCCGTTTGGG No data
923412723_923412726 1 Left 923412723 1:233725829-233725851 CCTTTTACCAGTTTGCACAGGGA 0: 39
1: 58
2: 56
3: 46
4: 310
Right 923412726 1:233725853-233725875 AGAGAAGCCAAAGGCCCGTTTGG No data
923412723_923412732 20 Left 923412723 1:233725829-233725851 CCTTTTACCAGTTTGCACAGGGA 0: 39
1: 58
2: 56
3: 46
4: 310
Right 923412732 1:233725872-233725894 TTGGGAGCATGTCAGGTTTCTGG No data
923412723_923412733 21 Left 923412723 1:233725829-233725851 CCTTTTACCAGTTTGCACAGGGA 0: 39
1: 58
2: 56
3: 46
4: 310
Right 923412733 1:233725873-233725895 TGGGAGCATGTCAGGTTTCTGGG No data
923412723_923412725 -8 Left 923412723 1:233725829-233725851 CCTTTTACCAGTTTGCACAGGGA 0: 39
1: 58
2: 56
3: 46
4: 310
Right 923412725 1:233725844-233725866 CACAGGGAAAGAGAAGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923412723 Original CRISPR TCCCTGTGCAAACTGGTAAA AGG (reversed) Intergenic
900963213 1:5939133-5939155 TCTCGGGGCAAACTGGAAAAGGG + Intronic
903148982 1:21391768-21391790 TCTCTGTGCAAACTGGTTGTAGG + Intergenic
905708016 1:40076834-40076856 TCCCTGTACACACAGGTAACTGG - Exonic
906410328 1:45573728-45573750 TCCCCATACAAACTGGTAAAAGG - Intergenic
907549756 1:55294807-55294829 TCCCTTTGAAAACTGGCACAAGG + Intergenic
907841808 1:58165420-58165442 TCCTTTTGCAGACTGATAAAAGG - Intronic
908373218 1:63504581-63504603 TCCCTTTGAAAACTGGCACAAGG - Intronic
909736729 1:78970960-78970982 TCCCTATGCAAACTGGTAAAAGG + Intronic
909863618 1:80638003-80638025 TCCCAGTGCAAACTGGTAAAAGG + Intergenic
910600846 1:89030604-89030626 TCCCTTTGAAAACTGGCACAAGG - Intergenic
910626505 1:89313478-89313500 TCCCTGTATAAGCTGGTAAAAGG - Intergenic
912111162 1:106345082-106345104 TCCCTGTGCAAACTGGTAAATGG - Intergenic
913030448 1:114897425-114897447 TCCCTGTGCAAACTGGTAAAAGG - Intronic
913103547 1:115592251-115592273 TCCCTGTACAAACTGGTAAAAGG + Intergenic
913712552 1:121500250-121500272 TCCCTTTGAAAACTGGCACAAGG + Intergenic
914401880 1:147328671-147328693 TCCCTTTGAAAACTGATACAAGG + Intergenic
915656480 1:157365143-157365165 TTCCTGTGCAAACTGGTAAAAGG - Intergenic
915672807 1:157504428-157504450 TTCCTGTGCAAACTGGTAAAAGG + Intergenic
915824041 1:159056670-159056692 TCCTTGTGCAAACTGATAAAAGG - Intergenic
915998857 1:160594785-160594807 TCCCTTTGAAAACTGGCACAAGG + Intergenic
916393689 1:164361600-164361622 TCCCTTTGCAATCTTCTAAATGG - Intergenic
917274801 1:173320404-173320426 TCCCTTTGAAAACTGGCACAAGG + Intergenic
917557126 1:176101643-176101665 TCCCTGCACTAACTAGTAAAAGG + Intronic
918174990 1:182035780-182035802 TCCCAGTGCAAACTGGTAAAAGG - Intergenic
919304880 1:195819482-195819504 TCCCTTTGAAAACTGGCACAAGG - Intergenic
920640113 1:207743653-207743675 TCCCTGTGCAAACCAGTAAACGG + Intergenic
921621752 1:217333129-217333151 TCTTTGTGGAAACTGGGAAAGGG + Intergenic
922567776 1:226612115-226612137 TCCCTGTGCAAACTGGTAAAAGG - Intergenic
923222591 1:231909240-231909262 TCCCTTTGAAAACTGGCACAAGG - Intronic
923412723 1:233725829-233725851 TCCCTGTGCAAACTGGTAAAAGG - Intergenic
923913915 1:238481773-238481795 TCCCTTTGCAAACTGGTAAAAGG - Intergenic
924831721 1:247602963-247602985 TTCTTGTGCAAAAGGGTAAATGG - Intergenic
1063048035 10:2414304-2414326 TCTCCGAGAAAACTGGTAAAGGG + Intergenic
1063302580 10:4864532-4864554 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1064332217 10:14404665-14404687 TCGCTGTGCAATCTTGAAAAAGG - Intronic
1064894194 10:20215493-20215515 TCCCTTTGCAAACTGGAATTTGG + Intronic
1065441824 10:25760683-25760705 TCCCAGAGCAAACAGGAAAAGGG - Intergenic
1066516030 10:36161775-36161797 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1066710774 10:38231086-38231108 TCCCTGTGCAAACTGGTGAAAGG + Intergenic
1066812363 10:39356527-39356549 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1068480025 10:57578539-57578561 TCCCTGTGCAAACTGGTAAAAGG - Intergenic
1071012294 10:80953043-80953065 TCCCTGTGCAAACTGGTAAAAGG - Intergenic
1073574681 10:104612546-104612568 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
1073632347 10:105161465-105161487 TCTCAGTGCAAAGTGGGAAAAGG - Intronic
1074674647 10:115834551-115834573 TACCAGAGCAAAATGGTAAAGGG - Intronic
1077770927 11:5218078-5218100 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1077865067 11:6215191-6215213 GACCTGTCCAAACTAGTAAAGGG - Intronic
1078964310 11:16320143-16320165 CCCTTGTGCAAACAGATAAAAGG - Intronic
1080200736 11:29666717-29666739 TCCCTCTGAAAACTGGAACAAGG + Intergenic
1080307661 11:30854124-30854146 TCAGTGTGAAAACTGGTAAGAGG + Intronic
1080889940 11:36400835-36400857 GCCCTGTGCAAACTTGTGAATGG + Intronic
1080941326 11:36921746-36921768 TCCCTGTGCAAACTGGCAAAAGG - Intergenic
1081509126 11:43750900-43750922 TACCTGTGACAACTGGGAAAGGG - Exonic
1081798204 11:45837091-45837113 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1082121379 11:48383616-48383638 TCCCTGTACAAAATAGTAAAAGG - Intergenic
1082252483 11:49997014-49997036 TCCCTGTACAAAATAGTAACAGG + Intergenic
1082555368 11:54557867-54557889 TCCCTGTACAAAATAGTAAAAGG - Intergenic
1082713830 11:56588736-56588758 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1082747791 11:56984946-56984968 TCCCTGTGTAAACTGGTAAAAGG - Intergenic
1082944349 11:58741781-58741803 TTCCTGTGCAAACCAGTAAAAGG + Intergenic
1082951651 11:58822493-58822515 TCCCTTTGAAAACTGGCACAGGG - Intergenic
1083533958 11:63451855-63451877 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1084879902 11:72163468-72163490 TCCCTGTGCAAACTGGTAAAAGG - Intergenic
1085201102 11:74702793-74702815 TACCTCTGGAAGCTGGTAAAAGG - Exonic
1085211464 11:74783599-74783621 TCCCTGTAAAAGCTGGTAGAAGG + Intronic
1085566659 11:77520471-77520493 TCCCTGTGCAAACAGGTAAAAGG - Intronic
1085716408 11:78877553-78877575 TCCCTGGGCAATGTTGTAAAAGG + Intronic
1085946363 11:81277912-81277934 TCTCTGTGCAAACTGGTAAAAGG + Intergenic
1086058931 11:82680849-82680871 TTCCAGTGCAAACCAGTAAAAGG - Intergenic
1086296453 11:85373200-85373222 TCTCTGTGCAAACTGGTAAAAGG + Intronic
1089218572 11:116851622-116851644 TCTCTGAGCAAAGAGGTAAAAGG + Intronic
1090715334 11:129425486-129425508 TCCATGTGCTAACTGGCCAATGG + Intronic
1090755052 11:129783336-129783358 TAGTGGTGCAAACTGGTAAAAGG - Intergenic
1090946657 11:131435856-131435878 TCCCTTTGAAAACTGGCACAAGG - Intronic
1091019464 11:132086721-132086743 TCCCTGTGCAAACCAGTAAAAGG - Intronic
1092563106 12:9637211-9637233 TCCCTGTGTGAACTGGTAAAAGG - Intergenic
1092567529 12:9684450-9684472 TCCCTTTGTAAACTGGCACAAGG - Intronic
1092585690 12:9899073-9899095 TCCCTGTGCAAACTGATAAAAGG - Intronic
1093987884 12:25557954-25557976 TCCCTCTGCAAACAGGATAAAGG + Intronic
1094111186 12:26864493-26864515 TCCCTGTAGATACTGGAAAAGGG - Intergenic
1094332544 12:29311017-29311039 TTCCTATGCAGACTGGGAAAGGG + Exonic
1095077089 12:37944008-37944030 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1095393389 12:41735361-41735383 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1095572752 12:43701268-43701290 TACCTGTGCAAACTGGTAAAAGG + Intergenic
1095922462 12:47544550-47544572 TTTGTGTGAAAACTGGTAAAGGG - Intergenic
1096044969 12:48554355-48554377 TCACTGTGCAAAATGGCAAAAGG - Intergenic
1096353318 12:50917975-50917997 TCCCTGTGCAAACCAGTAAAAGG + Intergenic
1097139833 12:56891969-56891991 TCCCTCTGAAAACTGGCACAAGG + Intergenic
1097499792 12:60388185-60388207 TTCCTGTGCAAACTGGTAAAAGG - Intergenic
1097601284 12:61695645-61695667 TTCTTGTGCAAACTAGTAAAAGG + Intergenic
1098436814 12:70476578-70476600 TCCCTGTACAAACTGGTAAAAGG + Intergenic
1098802380 12:74978033-74978055 TCTCAGGGCAAACTGGAAAAAGG + Intergenic
1098805503 12:75016460-75016482 TCCCTGTGCAAACTGGTAAACGG - Intergenic
1098839624 12:75463189-75463211 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1099261640 12:80389859-80389881 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1099534588 12:83828289-83828311 TCCTTGTGCAAACTGGTAAAAGG - Intergenic
1099777253 12:87149833-87149855 TCACTATGAAAACTGTTAAAAGG - Intergenic
1099785854 12:87262310-87262332 TCTCTGTGCCAAATGGTACATGG + Intergenic
1099824089 12:87752427-87752449 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1101383544 12:104235552-104235574 TCCTTGTGCAAACCAGTAAAAGG + Intronic
1101623854 12:106419100-106419122 TTCCTGTGGAAACTGGCAAAAGG - Intronic
1101775466 12:107789318-107789340 TCTCTGTGCAAACAAGTAAAAGG - Intergenic
1102946144 12:116990096-116990118 TGGCTTTGCAAACTAGTAAATGG + Intronic
1104920482 12:132287983-132288005 TCTCTGTGCAAGCTGACAAAAGG - Intronic
1105051148 12:133052286-133052308 TCCATGTACACACTGGGAAAAGG - Intronic
1105424979 13:20286074-20286096 TCTCTGTGCAAACTGGTTGCAGG + Intergenic
1106027720 13:25971227-25971249 TCCATCTGCAAACTGGATAATGG + Intronic
1108204237 13:48072034-48072056 TCCGTGTGCAAACTGGTAAAAGG + Intronic
1108514976 13:51192538-51192560 TTCCTGTGGAAACTGCTGAAAGG - Intergenic
1109013020 13:56974663-56974685 TCCCTGTGCAAACTGGCAAAAGG + Intergenic
1109388774 13:61667037-61667059 TCTCTGTGCAATCTGGTAAAAGG - Intergenic
1109393757 13:61726469-61726491 TCCCTTTTCACACTGCTAAAAGG + Intergenic
1109609024 13:64739053-64739075 TCTCTGTGCAAACTGGTTGTGGG + Intergenic
1109745430 13:66617649-66617671 TCCCTGTGCAAACTGGTAAAAGG + Intronic
1109865782 13:68261086-68261108 TTCCTGTGCAAACTGGTGAAAGG + Intergenic
1110257161 13:73444980-73445002 TCCCTGGGCAAACTGGTAAAAGG + Intergenic
1110327817 13:74238009-74238031 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1110990570 13:82038438-82038460 TCCCTGTGTAAACTGGTAAAAGG - Intergenic
1111133016 13:84000277-84000299 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
1112549240 13:100404223-100404245 TCCCTGTGCAAACTGGTAAAAGG - Intronic
1113910054 13:113837474-113837496 TCCCCCTGCAAAGTGGCAAAGGG + Intronic
1114240635 14:20864182-20864204 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1115340603 14:32289828-32289850 TACCTTTGAAAACTGGTACAAGG - Intergenic
1116389916 14:44379865-44379887 TCCCTGTGTAAACTGGTAAAAGG - Intergenic
1117194084 14:53322123-53322145 TCCCTTTGAAAACTGGCAGAAGG + Intergenic
1118521530 14:66591227-66591249 TCCCTTTGAAAACTGGCACAAGG + Intronic
1118550017 14:66939989-66940011 TCCCTGTACAGACTGGTCAAAGG - Intronic
1118952240 14:70445578-70445600 CTCCTGTGCAAACTGGTAAAGGG - Intergenic
1118999630 14:70870678-70870700 TACCTGTACAAACTGGTAAAAGG - Intergenic
1119037188 14:71240408-71240430 TTCCTGTGCAAACAAGGAAATGG + Intergenic
1120300686 14:82702431-82702453 TCCCCTTGAAAACTGGCAAAAGG - Intergenic
1120314355 14:82872464-82872486 TCCCTGTGCAAATTGATAAAAGG + Intergenic
1121174115 14:91877617-91877639 TCCCGGTACAAGATGGTAAAGGG + Exonic
1121823610 14:96992159-96992181 TCCTTGTGAAAACTGGGTAAAGG + Intergenic
1124046171 15:26152084-26152106 TCCCTCTGAAAACTGGCACAAGG - Intergenic
1124196390 15:27634188-27634210 TCCCTGTGCCTACTGTAAAATGG + Intergenic
1125062162 15:35437530-35437552 TCCTGGTGCAAACCGGTAAAGGG + Intronic
1126214888 15:46143524-46143546 TCTCTGTGCAAACTGGTTGTAGG + Intergenic
1126995088 15:54433655-54433677 TCCCTTTGAAAACTGGCACAAGG + Intronic
1127844741 15:62859606-62859628 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1128243943 15:66120147-66120169 ACCCTGTGAAACCTGGTAGAGGG - Intronic
1128561587 15:68672134-68672156 TCCCTGAGCAACTTGGTAATCGG + Intronic
1128912033 15:71524279-71524301 TCACTGTGCAAACCTGCAAATGG - Intronic
1129412041 15:75355559-75355581 CCCCTGTGCCAGCAGGTAAAGGG - Exonic
1130036867 15:80368847-80368869 TCCCTTTGCAAACTGGTAAAAGG + Intronic
1131696143 15:94880219-94880241 TCTCTGTGCAAACTGGTTGAAGG - Intergenic
1134312557 16:13088880-13088902 TCCCTTTGAAAACTGGCACAAGG - Intronic
1134881189 16:17746625-17746647 AGCCTGTGCAAGCTGGTAAGAGG + Intergenic
1135077147 16:19403419-19403441 TCCCTGTGCAAACTGATAAAAGG - Intergenic
1136351659 16:29712696-29712718 TCCCTGTGCAAACCGGTAAAAGG + Intergenic
1138837453 16:60456060-60456082 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1140343564 16:74189815-74189837 TCCCACTGCAAACTGGGCAAAGG - Intergenic
1142911945 17:3101591-3101613 TCCCTTTGAAAACCGGTACAAGG + Intergenic
1142935662 17:3328627-3328649 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1143369101 17:6427230-6427252 TCTTTGTGCAAACTAGGAAAAGG + Intronic
1143533881 17:7524075-7524097 TCCTTGTGCAAACCAGTAAAAGG - Intergenic
1144228351 17:13173876-13173898 TCCCTGTGCCAGTTGGTAAAAGG + Intergenic
1144593101 17:16541383-16541405 TTCCTGTGGAAACCGGCAAAAGG + Intergenic
1145902317 17:28496907-28496929 TCCCTGTGCTAACAGGGGAAAGG - Intronic
1146039100 17:29434098-29434120 TCCCTGTGAAAATTGGTAAAAGG - Intronic
1146912372 17:36657062-36657084 TCCCTCCGCAGACTGGGAAAGGG - Intergenic
1149034333 17:52116798-52116820 TCCCTGTGCACACCAGTAAGAGG + Intronic
1149973120 17:61238688-61238710 ACCCCGTGGAAACTGGGAAATGG - Intronic
1150874151 17:68949865-68949887 TCCCTTTGAAAACTGGCACAAGG + Intronic
1151646991 17:75439501-75439523 TCTCTGGGCAAACAGGAAAAGGG - Intergenic
1153526084 18:5995949-5995971 TCTCAGGGCAAACTGGAAAAGGG - Intronic
1153548273 18:6233241-6233263 TCCCTCTGAAAACTGGCACAAGG + Intronic
1154012134 18:10583567-10583589 TCCGTGTGGATACTGGTGAAAGG + Intergenic
1155784511 18:29880173-29880195 TCACTGTGCAAACTGGTAAAAGG - Intergenic
1156698450 18:39795761-39795783 TCCCTCTGCAAACTGGTAAAAGG - Intergenic
1158114117 18:53975830-53975852 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1158308388 18:56131906-56131928 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1158641403 18:59207021-59207043 TTCCTGGGCAAACTGGTAAAAGG + Intergenic
1159784495 18:72697165-72697187 TCTCTGTGCAAACTGGTAAAAGG + Intergenic
1159956229 18:74520122-74520144 TCCCTGGGCAAGTTGGAAAAGGG - Exonic
1160282190 18:77501564-77501586 CCACTGTGCAGCCTGGTAAATGG - Intergenic
1164195451 19:22953585-22953607 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1165261341 19:34621728-34621750 TCCCTGTGCAAACCAGTGAAAGG - Intronic
1165262199 19:34629191-34629213 TCCCTTTGAAAACTGGCACAAGG + Intronic
1165776933 19:38410182-38410204 TCCCTGCCCAGACTGGTAAGTGG + Intronic
1167242098 19:48350376-48350398 TCCATGTGCAAATTAGAAAAAGG - Intronic
926500625 2:13648839-13648861 TCTCTGTGCAAACTGGTTGTGGG - Intergenic
927038429 2:19204279-19204301 AGCCTCTGCAAACTGCTAAAAGG + Intergenic
928646743 2:33361976-33361998 AACTTGTGCACACTGGTAAAAGG - Intronic
928852876 2:35770202-35770224 TCCCTTTGAAAACTGGCACAAGG + Intergenic
929398648 2:41553566-41553588 TCCCTTTGAAAACTGGCACAAGG + Intergenic
929727494 2:44445719-44445741 TCCCCATGCAAACTGGTAAAAGG + Intronic
930272184 2:49269958-49269980 GCCATATGCAAACTGCTAAATGG - Intergenic
930478437 2:51915357-51915379 TCCCTTTGAAAACTAGTACAGGG + Intergenic
931538361 2:63302618-63302640 TCCCTGTGCAAATTGGTAAAAGG + Intronic
933488038 2:82948327-82948349 TCCCTTTACACAATGGTAAAGGG - Intergenic
933545672 2:83708166-83708188 TCCCTTTGAAAACTGGCACAAGG - Intergenic
934932136 2:98435271-98435293 TCCCTGCGCAAACTGGTAAAAGG + Intergenic
935450595 2:103204607-103204629 TCCCTTTGAAAACTGGCACAAGG + Intergenic
936285227 2:111176458-111176480 TGCCAGGGCAAACTGGCAAAGGG - Intergenic
936840099 2:116758357-116758379 TCCCTGGGCCAACTGGTAAAAGG + Intergenic
937727619 2:125186297-125186319 TCCCCATGCAAACTGGTAAAAGG - Intergenic
938276954 2:130035251-130035273 TTCCTGTGCAGGCTGGGAAAGGG - Intergenic
938362025 2:130695456-130695478 TTCCTGTGCAGGCTGGGAAAGGG + Intergenic
938438432 2:131302144-131302166 TTCCTGTGCAGGCTGGGAAAGGG + Intronic
940423159 2:153501984-153502006 TCTCTGTGCAAACTGGTTGTAGG - Intergenic
940826877 2:158422655-158422677 TCCCTTTGAAAACTGGCACAAGG + Intronic
940942629 2:159579990-159580012 TCCCTTTGAAAACTGGCACAAGG + Intronic
941534364 2:166704798-166704820 TCCCTTTGAAAACTGGCACAAGG - Intergenic
941623617 2:167806398-167806420 TCCCTTTGAAAACTGGCACAAGG - Intergenic
941714806 2:168752572-168752594 TCCCTGTGGAAGCTGGTGATGGG + Intronic
941763322 2:169268674-169268696 TCCCTTTGAAAACTGGCACAAGG + Intronic
942434989 2:175961624-175961646 TCCCTTTGAAAACTGGCACAAGG + Intronic
942620213 2:177837101-177837123 TCCGTGTGCAAACCGGTAAAAGG + Intronic
942767207 2:179470605-179470627 TCTCTGTGCAAACTGGTTGAAGG + Intronic
942839367 2:180340851-180340873 TTCCTGTGAAAACTGGTAAAAGG + Intergenic
943915897 2:193632215-193632237 TCCCTTTGAAAACTGGCACAAGG + Intergenic
944291173 2:198006865-198006887 TGCCTTTAGAAACTGGTAAAAGG - Intronic
945380331 2:209132464-209132486 TCCCTTTGAAAACTGGCACAAGG + Intergenic
945561690 2:211347777-211347799 TCCCTGTACGAAGTGGTAAAAGG - Intergenic
945818489 2:214634432-214634454 TCCCTTTGAAAACTGGCACAAGG - Intergenic
946297193 2:218794533-218794555 TCCCTGGGCAAACTGGTAAAAGG - Intronic
946899813 2:224361410-224361432 TCCTTGTGTAAATTGGAAAAAGG + Intergenic
948115157 2:235490045-235490067 TGCCTCTACAAACTGGAAAATGG - Intergenic
1170222279 20:13953193-13953215 TCCCTGTGCAAACTGGTAAAAGG + Intronic
1170600630 20:17838814-17838836 TCCCAGGGCAAACTGGGAAGGGG - Intergenic
1172777734 20:37417207-37417229 TCCATGTGCACACTGGGAAGGGG - Intergenic
1176306492 21:5126262-5126284 TCCCTTTGCAAACTGGGGTATGG + Intronic
1177332435 21:19681015-19681037 CCCCTGTGCAAACCAGTACAAGG + Intergenic
1177504610 21:22003749-22003771 TCTCTGGGCAAACGAGTAAAGGG - Intergenic
1177543089 21:22520795-22520817 TCTCTGTGCAAGCTGGTAAAAGG + Intergenic
1178836122 21:36098989-36099011 TCCCTGTGCAAACAAGTAAAAGG + Intergenic
1179850567 21:44135768-44135790 TCCCTTTGCAAACTGGGGTATGG - Intronic
1181009386 22:20031698-20031720 TCCCTGGGCAAGCTGGTGATGGG - Intronic
1181446275 22:22977397-22977419 TCCCTGTGCAAACCAGTAAAAGG + Intergenic
1183113427 22:35669957-35669979 TCTCTGTGCAAACTGGTCGAAGG + Intergenic
951345977 3:21547316-21547338 TCCCTGTGCAAACTGGTAAAAGG + Intronic
952133179 3:30387753-30387775 TCCCTTTGAAAACTGGCACAAGG - Intergenic
952193375 3:31047100-31047122 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
952455095 3:33465452-33465474 TCCCCATGCAAACTGGTAAAAGG - Intergenic
952521217 3:34159495-34159517 TTCTTTTGGAAACTGGTAAAGGG + Intergenic
952601819 3:35092644-35092666 TCCCTCTGAAAACTGGAACAAGG + Intergenic
952637062 3:35545397-35545419 TACCAGTGTAAACTGGTAAAAGG - Intergenic
953441644 3:42923902-42923924 TCCCTGTGCAAACCAGTAAAAGG - Intronic
953647520 3:44768956-44768978 TCCCTGTGCAAACCAGTAAAAGG - Intronic
955613341 3:60780451-60780473 TACGTGTGCAAACTGGCAAAAGG + Intronic
956355060 3:68381840-68381862 TCCCTTTGAAAACTGGCACAAGG - Intronic
956993634 3:74798262-74798284 TCCCTTTGAAAACTGGCACAAGG + Intergenic
957028158 3:75208845-75208867 TCCCTGTGCAAAAGGTTAAAAGG + Intergenic
957288655 3:78249112-78249134 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
957354228 3:79060921-79060943 TCCCTTTGAAAACTGGCACAAGG + Intronic
957574578 3:81991043-81991065 TCCCTGTGCTAACTGGTAAAAGG + Intergenic
957715999 3:83929964-83929986 TCCCTTTGCAAACTGGTAAAAGG + Intergenic
957849653 3:85790855-85790877 TCTCTGTGGAAACTGGCAAGCGG + Intronic
957952644 3:87145493-87145515 TCCCTATGCAAACTGGTAAAAGG + Intergenic
957972005 3:87394266-87394288 TCCCTCTGGAAACTGGAACAAGG + Intergenic
958191419 3:90189722-90189744 TCCCTTTGAAAACTGGCACAAGG - Intergenic
958536644 3:95412287-95412309 TCACTGTGAAAACTGGTAAAAGG + Intergenic
958631608 3:96690669-96690691 TCCCTTTGCCAACTGGAAGAAGG + Intergenic
958750285 3:98187222-98187244 TCCCTGTGCAAGCCGGTAAAAGG - Intronic
959275953 3:104277867-104277889 TCACTGTGCAAACCAGTAAAAGG - Intergenic
959439403 3:106358294-106358316 TGCCTGTGCAAACATGTACATGG - Intergenic
959744722 3:109763216-109763238 TCCCTTTGAAAACTGGCACAAGG + Intergenic
961658191 3:128454580-128454602 TCCCTGAGCAACCTGGAATATGG + Intergenic
963174343 3:142282376-142282398 TCCCTGAGTAAACTGGTAAAAGG + Intergenic
963396441 3:144740642-144740664 TCCCTTTGGAAACTGGCACAAGG - Intergenic
963462915 3:145639858-145639880 TCCCAGGGAAAACTGGTAAGGGG + Intergenic
963695422 3:148560982-148561004 TCCCTTTGAAAACTGGCACAAGG - Intergenic
964126384 3:153237829-153237851 TCCCTTTGAAAACTGGCACAAGG - Intergenic
964189488 3:153985470-153985492 TCCCTTTGAAAACTGGCACAAGG - Intergenic
964304382 3:155325210-155325232 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
964831623 3:160890067-160890089 TTCCTTTGAAAACTGGTACAAGG + Intronic
965988046 3:174780551-174780573 TCCCTTTGAAAACAGGTACAAGG - Intronic
966523746 3:180899531-180899553 TCCCTGTGCAAACTGGTAAAAGG + Intronic
967531089 3:190549611-190549633 TCTCTGTGCAAACTGGTAAAAGG - Intronic
967542167 3:190680381-190680403 TCCCTGTGCAAACCGGTAAAAGG + Intergenic
967542259 3:190681080-190681102 TCCCTGCGCGAACTGGTAAAAGG + Intergenic
967577266 3:191108248-191108270 AGCCTGTGCACACTGGTACAAGG - Intergenic
967712756 3:192727755-192727777 TTCCTCTGCAAACTAGAAAATGG + Intronic
968381512 4:100697-100719 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
968751819 4:2394017-2394039 TAGCTGTGCAAGCTGGAAAAGGG - Intronic
970288278 4:14542965-14542987 TCTCTGTGAAAACTGGCACAAGG + Intergenic
970335835 4:15041206-15041228 TCCATGTGCAGACTAGTAGATGG + Intronic
970927286 4:21467537-21467559 TCCCTCTGCAAAAAGATAAAAGG + Intronic
971968676 4:33594278-33594300 TACCTGTGCAAACTGGTAAAAGG + Intergenic
972934957 4:44122694-44122716 TCCCTTTGAAAACTGGCACAAGG + Intergenic
973347422 4:49071904-49071926 TCCCTTTGAAAACTGGCACAAGG + Intergenic
973864419 4:55097509-55097531 CCCTTGTGCAAATTGGAAAAAGG - Intronic
974203649 4:58671326-58671348 TCCCTATGCAAACTAGTAAAAGG + Intergenic
974675165 4:65079396-65079418 TCCATGTTCAAACTGGTAAAAGG + Intergenic
974963790 4:68735759-68735781 TCCCTGTGCAAAGTGATAAAAGG - Intergenic
975424375 4:74209129-74209151 TCCCTGTGCAAACTGGTAAAAGG - Intronic
975532744 4:75417973-75417995 TCCCTTTGAAAACTGGCACAAGG - Intergenic
975756647 4:77578136-77578158 TCCCTGTGCAAACTGGTAAAAGG + Intronic
976067465 4:81205037-81205059 TCCCTGAGCAAAATGGGAAATGG - Exonic
976139227 4:81972761-81972783 TCCTTGTGCAAAGTGTGAAAAGG - Intronic
976345365 4:83993743-83993765 ACCCTATGCAAACTGGTAAAAGG + Intergenic
976940995 4:90702043-90702065 TCCCTTTGAAAACTGGCACAAGG - Intronic
977500624 4:97832437-97832459 TCCCTTTGAAAACTGGCATAAGG + Intronic
977824060 4:101508983-101509005 TCCCTTTGAAAACTGGCACAAGG - Intronic
978179161 4:105772426-105772448 TCCCTTTGAAAACTGGCACAAGG - Intronic
978328572 4:107586864-107586886 TTCCTGTGCAAACTGGTAAAAGG - Intergenic
979014947 4:115420447-115420469 TCCCTGTGCAAACCAGTAAAAGG + Intergenic
979104633 4:116668159-116668181 TCCCTGTGCAAACCGATAAAAGG + Intergenic
979507429 4:121514310-121514332 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
979628164 4:122869905-122869927 TCCCTTTGAAAACTGGCACAAGG - Intronic
979706426 4:123725449-123725471 TCCCTTTGAAAACTGGCACAAGG + Intergenic
979819067 4:125148476-125148498 TCCCTTTGAAAACTGGCACAAGG - Intergenic
980642474 4:135597884-135597906 TCCCCATGCAAACCGGCAAAAGG + Intergenic
980670361 4:135996546-135996568 TCCCATTACAAAATGGTAAAAGG + Intergenic
980722948 4:136720933-136720955 TCCATGTGCAAACTTATAAAAGG + Intergenic
981255973 4:142660669-142660691 TCTCCATGCAAACTGGTAAAGGG + Intronic
981456811 4:144962263-144962285 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
981770692 4:148304379-148304401 TCCCTGTACAAACTGGTAAAAGG + Intronic
982477616 4:155872629-155872651 TCCCTGTGCAAACTGGTAAAAGG - Intronic
982606884 4:157527046-157527068 TCCCTGTGCGAACTGGCAAAAGG - Intergenic
983129747 4:164003114-164003136 TATCTGTGCAAAATGGTATAAGG + Intronic
983685482 4:170403356-170403378 TCCCTCTGCCAACTGGAACAAGG - Intergenic
984327848 4:178275649-178275671 TCTGTGTGCAAACTGGTAAAAGG + Intergenic
984834819 4:184010042-184010064 TCCCTGGGCACCCTGGTAAGAGG - Exonic
986189173 5:5478046-5478068 TCCCTTTGAAAACTGGCACAAGG + Intronic
986213782 5:5699043-5699065 TCCCTGTGCAGACTGGTAAAAGG + Intergenic
987446179 5:18022144-18022166 TGACTATGCAAACTGGTCAAAGG - Intergenic
987966621 5:24885722-24885744 TCCCTTTGAAAACTGGCACAAGG + Intergenic
988157805 5:27477233-27477255 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
988250909 5:28756891-28756913 TCCCTTTGAAAACTGGCACAAGG - Intergenic
988899599 5:35718116-35718138 TCCCTGTGCAAACTGGTAAAAGG - Intronic
989091516 5:37738608-37738630 TCCCTCTGCAATCTTCTAAAAGG - Intronic
989517169 5:42357246-42357268 TCCCTTTGAAAACTGGCACAAGG + Intergenic
989715168 5:44454402-44454424 TCTCTGTTAAAACTGGTAAAAGG - Intergenic
991076428 5:62544522-62544544 TCCCTTTGAAAACTGGCACAAGG + Intronic
994599893 5:101889301-101889323 TCCCTTTGAAAACTGGTACAAGG - Intergenic
995393465 5:111663665-111663687 TCCCTGAGCAAACTGGTAAAAGG - Intronic
995581583 5:113607959-113607981 TCTCTGGGCAAACTGGTAAAAGG + Intergenic
996280330 5:121722443-121722465 TCCCTTTGAAAACTGGCACAAGG - Intergenic
996476635 5:123929911-123929933 TCCCTGTGCAAACCAGTAAAAGG - Intergenic
996575430 5:124972687-124972709 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
996679294 5:126213520-126213542 TACCTGTACAAACTGGGCAAAGG - Intergenic
996682807 5:126246548-126246570 TCCCTTTGAAAACTGGCACAAGG - Intergenic
997075166 5:130665909-130665931 TCCCCTTGCAAACTGGCACAAGG - Intergenic
998769299 5:145523885-145523907 TGCATGTGCAAACTAGTACAAGG - Intronic
998887536 5:146709911-146709933 GCCCTGTGCAAAGTGCTATAAGG - Intronic
999008264 5:148006015-148006037 CTCCTATACAAACTGGTAAAAGG + Intergenic
999657228 5:153822417-153822439 TCCCTGGGAAATCTGGTTAAGGG - Intergenic
1000061092 5:157655750-157655772 TCTCTGTGCAAACTGGTTGTAGG + Intronic
1000066375 5:157696050-157696072 TCTCTGTGCAAACTGGTTGTAGG + Intergenic
1001448522 5:171806389-171806411 TTCCTGTGGAAAGTGGTAAACGG + Intergenic
1002183167 5:177441843-177441865 TCACTGTGCAAAACTGTAAACGG - Exonic
1004610463 6:17234832-17234854 TCCCTGGAGAAACTGGTAATAGG - Intergenic
1005119315 6:22372371-22372393 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
1005181677 6:23114012-23114034 TCCCTGCACAAACCAGTAAAAGG - Intergenic
1007123154 6:39400282-39400304 AAGCTGTGCAAACTGGAAAAGGG + Intronic
1007608116 6:43130849-43130871 CCTTTGTGCAAACTGGAAAAGGG - Intronic
1008263096 6:49390813-49390835 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1008297259 6:49793552-49793574 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1008829399 6:55739589-55739611 TCCCTTTGAAAACTGGCATAAGG + Intergenic
1009657578 6:66566880-66566902 TTCCTATGCAAACTGGCAAAAGG - Intergenic
1009735683 6:67673885-67673907 TCCTTGGGCAGAGTGGTAAAAGG - Intergenic
1009907541 6:69888269-69888291 TCCCTGTGCAAACTGGTAAAAGG - Intronic
1009907848 6:69891156-69891178 TCCCTGTGCAAACTGGTAAAAGG - Intronic
1010503116 6:76625208-76625230 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1010530568 6:76962905-76962927 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1010728705 6:79364958-79364980 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1011241621 6:85277494-85277516 TCCCTCTGCAAAATTCTAAATGG + Intergenic
1011298578 6:85849957-85849979 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1011299512 6:85859361-85859383 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1011339857 6:86302121-86302143 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1011591171 6:88972095-88972117 TCCCCATGCAAACTGGTAAAAGG + Intergenic
1011776417 6:90735809-90735831 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1012514483 6:100042814-100042836 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1012583847 6:100899012-100899034 TCCCTGTGCAAATTGGTAAAGGG + Intergenic
1012804719 6:103879303-103879325 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
1013546794 6:111166199-111166221 TCCCTGTGCAAACCAGTAAAAGG - Intronic
1013852315 6:114531025-114531047 TCCCTATGAGAACTGGAAAAAGG - Intergenic
1014063244 6:117097338-117097360 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1014163223 6:118194723-118194745 TCTCTGTGCAAACCGGTTAAAGG - Intronic
1014924924 6:127259081-127259103 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1015144718 6:129972775-129972797 TCTCTGTGCAAATTAGAAAATGG + Intergenic
1015859058 6:137656494-137656516 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
1016233436 6:141833028-141833050 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
1017343889 6:153357236-153357258 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
1017559694 6:155614284-155614306 TCCCTCTGCAAACTGGTAAAAGG - Intergenic
1018065206 6:160120187-160120209 TCTCTGTGCAAACTGGTTGCAGG - Intergenic
1018274645 6:162117735-162117757 TCTCTGTGCATAGAGGTAAAAGG - Intronic
1018555996 6:165051125-165051147 TCCCTGTGCAATCTGGTAAAAGG + Intergenic
1020350679 7:7215377-7215399 TCCCGGCACAAACTGGCAAAGGG - Intronic
1020391035 7:7658380-7658402 TCCCTTTGAAAACTGGCACAAGG - Intronic
1020555423 7:9664193-9664215 TCCCTGTGGAAACTGGTAAAAGG - Intergenic
1020677268 7:11197195-11197217 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
1020898652 7:13974925-13974947 TCCCTGTGCAGATTAGAAAAAGG - Intronic
1020956114 7:14741282-14741304 TCCCTGTGCAAACCAGTAAAAGG + Intronic
1021648258 7:22807821-22807843 TCCCTATGCAAACTGATAAAAGG + Intergenic
1022322157 7:29297614-29297636 TCTCTGTGCAAACTACTAAAAGG - Intronic
1023718791 7:43072080-43072102 GCCTTGTGCAAACTGGTAAAAGG - Intergenic
1024398363 7:48894554-48894576 TTCCTGTGCGAATTGGTAAAAGG + Intergenic
1024438052 7:49382013-49382035 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
1024655393 7:51447603-51447625 TCCCCATGCAAACTGGTAAAAGG + Intergenic
1027960807 7:84942561-84942583 TCTCTGTGCAAACGGTTGAATGG + Intergenic
1028139697 7:87259897-87259919 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1028442885 7:90884009-90884031 TCCCTTTGAAAATTGGTACAAGG + Intronic
1030245858 7:107384003-107384025 TCCCTGTGCAAACTGGTAGAAGG + Intronic
1030431055 7:109449703-109449725 TCCCTGAGCAAGCTGCTCAAGGG + Intergenic
1030469174 7:109941182-109941204 TACCTTTGCAAACAGCTAAACGG - Intergenic
1031835125 7:126672694-126672716 TCCCTATGCAAACTGGTAAAAGG + Intronic
1032251468 7:130261540-130261562 TCCTTGTGCAAACTGGTAAAAGG + Intergenic
1033866142 7:145692381-145692403 TCCCTGTGTAAACTGGTAAAAGG + Intergenic
1033902605 7:146161272-146161294 TCCCTTTGAAAACTGGCACAAGG + Intronic
1034231351 7:149531087-149531109 TCCCTGTGCAAACTGGTAAAAGG + Intergenic
1034314870 7:150121156-150121178 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1034360280 7:150490570-150490592 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1034368874 7:150576541-150576563 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1035742011 8:1935608-1935630 CCCCAGTGCTAACTGGTAACAGG - Intronic
1036955458 8:13183385-13183407 TCCCTTTGAAAACTGGCACAAGG - Intronic
1037111545 8:15168954-15168976 CTCCTGTGTAAACTGGTAAAAGG + Intronic
1037395755 8:18440941-18440963 CCACTGGGCAAACTGGTAAAGGG + Intergenic
1038093736 8:24284306-24284328 TCCCTTTGAAAACTGGTGCAAGG + Intergenic
1038283682 8:26188290-26188312 TCTCTTTGAAAACTGGTAACAGG + Intergenic
1038341183 8:26686549-26686571 TCACGGTGGAAACGGGTAAATGG - Intergenic
1038578267 8:28724352-28724374 TCCCTGTGTAAAGTTATAAATGG + Intronic
1039281887 8:35995193-35995215 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1041761307 8:61369804-61369826 TCCTTTGGCAAACTGGCAAAAGG - Intronic
1042415042 8:68509371-68509393 TCCCTGTGCACACTGCTAAAAGG - Intronic
1043378694 8:79679572-79679594 TCCCTTTGAAAACTGGCATAAGG + Intergenic
1043410254 8:79986346-79986368 TCCCTTTGAAAACTGGCACAAGG + Intronic
1043734727 8:83729257-83729279 TCTCTGTGCAAACTGGTTGTAGG - Intergenic
1044008141 8:86962468-86962490 TCTCTGTGCAAACTGGTAGCAGG - Intronic
1044129274 8:88500233-88500255 TCCCTTTGTAAACTGGCACAAGG - Intergenic
1044292412 8:90488074-90488096 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1044455831 8:92392169-92392191 TCCCTTTGAAAACTGGCGAAAGG - Intergenic
1045185824 8:99837176-99837198 TAGCTGTGGAAACTGGTGAAGGG + Intronic
1046068501 8:109223173-109223195 TCCCTGTGCAAACTGGTAAATGG + Intergenic
1047607840 8:126492259-126492281 TCCCTCTGTAAAATGGAAAAAGG + Intergenic
1047970991 8:130084394-130084416 TCTCTGTGCAATTTGGAAAAAGG + Intronic
1049871924 8:144986336-144986358 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1050508630 9:6371734-6371756 TCTCTCTGAAAGCTGGTAAAAGG - Intergenic
1050657824 9:7848266-7848288 TCTCTGTGCAAACAGGTGAATGG + Intronic
1050897416 9:10900621-10900643 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1051219444 9:14832752-14832774 TCCCTGTGCAAACCTGAAAAAGG + Intronic
1051702296 9:19837149-19837171 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1052059321 9:23941647-23941669 TCTCCATGCAAACTAGTAAAAGG - Intergenic
1052408690 9:28095254-28095276 TCCCTGTGCCTACTGCTAATTGG - Intronic
1052421211 9:28245374-28245396 TCCCTTTGAAAACTGGCACAAGG + Intronic
1052617109 9:30855137-30855159 GCCCCATGCAAATTGGTAAAAGG + Intergenic
1052645270 9:31226577-31226599 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1053082859 9:35192020-35192042 TCCCTATCCAAACTGGCAAAAGG - Intronic
1056945780 9:90995266-90995288 TCCCTTTGAAAACTGGCACAGGG - Intergenic
1057366763 9:94429734-94429756 TCTCGGTGCAAACAGGAAAACGG - Intronic
1057462583 9:95276822-95276844 TCTCTGGGCAAACGGGAAAAGGG - Intronic
1057656572 9:96958330-96958352 TCTCGGTGCAAACAGGAAAACGG + Intronic
1059261340 9:112979817-112979839 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1203444026 Un_GL000219v1:38042-38064 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1203514834 Un_KI270741v1:156951-156973 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1186026940 X:5323691-5323713 TACCTTTGCAAACTTGAAAAAGG - Intergenic
1186282448 X:8007851-8007873 TCCCTGTGCATACTGCACAAAGG - Intergenic
1187910696 X:24108757-24108779 TAACTCTGCAAACTGATAAATGG - Intergenic
1188763271 X:34057954-34057976 TACCTGTGCAAAGTCATAAAAGG + Intergenic
1188803547 X:34560069-34560091 TCCCTGTGCAAACGAGTAAAAGG - Intergenic
1189006367 X:36999384-36999406 TCCCCATGCAAACTGGTAAAAGG + Intergenic
1189006459 X:36999939-36999961 TCCCCATGCAAACTGGTAAAAGG + Intergenic
1189042227 X:37554421-37554443 TCCCCATGCAAACTGGTAAAAGG - Intronic
1189616478 X:42789342-42789364 TCCCTGTGCAAACCAGTAAAAGG - Intergenic
1189632890 X:42974244-42974266 TCACTGTGCAAACTGGTAAAAGG - Intergenic
1189702229 X:43723749-43723771 TCCCTTTGAAAACTGGCACAAGG - Intronic
1190361768 X:49656271-49656293 GCCCAGACCAAACTGGTAAAAGG - Intergenic
1190491152 X:50983667-50983689 TCCATGTGCAAACTGGTAAAAGG + Intergenic
1190548873 X:51558438-51558460 TCCCCATGCAAACTGGTAACAGG - Intergenic
1190921373 X:54856003-54856025 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1190996218 X:55612457-55612479 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1190997920 X:55629720-55629742 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1191003177 X:55683226-55683248 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1191075699 X:56451058-56451080 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1191644628 X:63467060-63467082 TCCCTATGCCAACTGGTAAAAGG - Intergenic
1191823222 X:65336204-65336226 TGTTTGTGCAAACTGGTTAAAGG - Intergenic
1192026703 X:67460518-67460540 TCCCTTTGAAAACTGGTATAAGG + Intergenic
1192777024 X:74255799-74255821 TCCTTGTGCAAACCGGTAAAAGG + Intergenic
1192865482 X:75127480-75127502 TCCCTTTGAAAACTGGCACAAGG + Intronic
1192922093 X:75717720-75717742 TCCCTTTGAAAACTGGTGCAAGG - Intergenic
1192934591 X:75846210-75846232 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1192943071 X:75933930-75933952 TCCCTTTGAAAACTGGAACAAGG + Intergenic
1193315312 X:80058116-80058138 TCTCTGTGCAAACTGGTTGTAGG - Intergenic
1193481762 X:82035913-82035935 TCTCTGTGCAAACTGGTAAAAGG + Intergenic
1193574381 X:83181611-83181633 TCTCTGTGCAAACTGGTTGCAGG - Intergenic
1193699869 X:84747544-84747566 TCCCCGTGCAAACTGATAAAAGG + Intergenic
1193945032 X:87724305-87724327 TCCCTGTGCAAACTGGTAAAAGG - Intergenic
1194059654 X:89181472-89181494 TCCCTGTGCAAACCAGTACAAGG - Intergenic
1194066322 X:89266716-89266738 TCCCTGTACAAACTGGTAAAAGG - Intergenic
1194131164 X:90084086-90084108 TCCCTGTGCAAACTGGTATAAGG - Intergenic
1194379873 X:93178607-93178629 TCCCTGTGCAAACTGGTTGCAGG + Intergenic
1194402670 X:93458166-93458188 TCCCTGTGCGAACTAGTAAAAGG - Intergenic
1194569282 X:95533335-95533357 TCCATGTGAAATCTGTTAAAAGG - Intergenic
1194627189 X:96239133-96239155 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1194809795 X:98375857-98375879 TCCCTGTGCAAACCAGTAAAAGG - Intergenic
1195451319 X:105016383-105016405 TCCCTTTGAAAACTGGCAGAAGG - Intronic
1195622410 X:106970398-106970420 TCCCTTTGAAAACTGGCATAAGG + Intronic
1195846315 X:109232859-109232881 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1196148843 X:112349933-112349955 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1196203838 X:112916452-112916474 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1196242742 X:113362434-113362456 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1196280229 X:113815567-113815589 TTCCTGAGGACACTGGTAAAGGG + Intergenic
1196520243 X:116663554-116663576 TTCCTGTGCAAACTGGAAAAAGG - Intergenic
1196563474 X:117177869-117177891 TCCCTGAGCAAACTGGTAAAAGG + Intergenic
1197038721 X:121908553-121908575 TCCCTGTACAAACTGGTAAAAGG + Intergenic
1197478344 X:126950796-126950818 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1198595839 X:138234791-138234813 TCCCTTTGAAAACTGGCACAAGG + Intergenic
1198646189 X:138809517-138809539 TCCCTTTGAAAACTGGCACAAGG + Intronic
1198660008 X:138958095-138958117 TCCCTTTGAAAACTGGCACAAGG - Intronic
1199043402 X:143140562-143140584 TCCCTGTACCAACTGGTAAAAGG - Intergenic
1199169814 X:144722289-144722311 TCCCCATGCAAAATGGTAAAAGG + Intergenic
1200720492 Y:6600835-6600857 TCCCTGTACAAACTGGTAAAAGG - Intergenic
1201242675 Y:11973767-11973789 TACCTTTGCAAGCTGGTAAAAGG - Intergenic
1201628426 Y:16041198-16041220 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1202043315 Y:20710500-20710522 TCCCTTTGAAAACTGGCATAAGG + Intergenic
1202350278 Y:23982383-23982405 TCCCTTTGAAAACTGGCACAAGG - Intergenic
1202520501 Y:25687738-25687760 TCCCTTTGAAAACTGGCACAAGG + Intergenic