ID: 923412724

View in Genome Browser
Species Human (GRCh38)
Location 1:233725836-233725858
Sequence TTCTCTTTCCCTGTGCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923412724_923412732 13 Left 923412724 1:233725836-233725858 CCAGTTTGCACAGGGAAAGAGAA No data
Right 923412732 1:233725872-233725894 TTGGGAGCATGTCAGGTTTCTGG No data
923412724_923412727 -5 Left 923412724 1:233725836-233725858 CCAGTTTGCACAGGGAAAGAGAA No data
Right 923412727 1:233725854-233725876 GAGAAGCCAAAGGCCCGTTTGGG No data
923412724_923412733 14 Left 923412724 1:233725836-233725858 CCAGTTTGCACAGGGAAAGAGAA No data
Right 923412733 1:233725873-233725895 TGGGAGCATGTCAGGTTTCTGGG No data
923412724_923412726 -6 Left 923412724 1:233725836-233725858 CCAGTTTGCACAGGGAAAGAGAA No data
Right 923412726 1:233725853-233725875 AGAGAAGCCAAAGGCCCGTTTGG No data
923412724_923412729 6 Left 923412724 1:233725836-233725858 CCAGTTTGCACAGGGAAAGAGAA No data
Right 923412729 1:233725865-233725887 GGCCCGTTTGGGAGCATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923412724 Original CRISPR TTCTCTTTCCCTGTGCAAAC TGG (reversed) Intergenic
No off target data available for this crispr