ID: 923412727

View in Genome Browser
Species Human (GRCh38)
Location 1:233725854-233725876
Sequence GAGAAGCCAAAGGCCCGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923412719_923412727 9 Left 923412719 1:233725822-233725844 CCCAAGGCCTTTTACCAGTTTGC 0: 13
1: 24
2: 27
3: 29
4: 174
Right 923412727 1:233725854-233725876 GAGAAGCCAAAGGCCCGTTTGGG No data
923412723_923412727 2 Left 923412723 1:233725829-233725851 CCTTTTACCAGTTTGCACAGGGA 0: 39
1: 58
2: 56
3: 46
4: 310
Right 923412727 1:233725854-233725876 GAGAAGCCAAAGGCCCGTTTGGG No data
923412720_923412727 8 Left 923412720 1:233725823-233725845 CCAAGGCCTTTTACCAGTTTGCA 0: 27
1: 28
2: 23
3: 29
4: 157
Right 923412727 1:233725854-233725876 GAGAAGCCAAAGGCCCGTTTGGG No data
923412724_923412727 -5 Left 923412724 1:233725836-233725858 CCAGTTTGCACAGGGAAAGAGAA No data
Right 923412727 1:233725854-233725876 GAGAAGCCAAAGGCCCGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923412727 Original CRISPR GAGAAGCCAAAGGCCCGTTT GGG Intergenic
No off target data available for this crispr