ID: 923437188

View in Genome Browser
Species Human (GRCh38)
Location 1:233978570-233978592
Sequence CTGCAATCCAGGATCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923437182_923437188 7 Left 923437182 1:233978540-233978562 CCTAGACAAAACCTGATGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 186
Right 923437188 1:233978570-233978592 CTGCAATCCAGGATCCCTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 137
923437185_923437188 -4 Left 923437185 1:233978551-233978573 CCTGATGCTGGGACTGCGGCTGC 0: 1
1: 0
2: 4
3: 32
4: 374
Right 923437188 1:233978570-233978592 CTGCAATCCAGGATCCCTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923437188 Original CRISPR CTGCAATCCAGGATCCCTGT GGG Intronic
900566505 1:3334820-3334842 CTGCAGTGCAGGATGGCTGTTGG - Intronic
906152192 1:43594048-43594070 CTGGAATGCAGGATCCCCATGGG + Intronic
915216223 1:154342389-154342411 CTCCAATGCAGAATCCCCGTAGG - Intronic
915784850 1:158598131-158598153 CTGCAGTCTAGGATGCCAGTTGG - Intergenic
916511484 1:165475564-165475586 CTGCAGGCCAGGCACCCTGTGGG + Intergenic
920883426 1:209900921-209900943 CTGGGCTCCAGGATTCCTGTGGG + Intergenic
921065496 1:211619641-211619663 CTGCAGGCCAGTGTCCCTGTTGG + Intergenic
923238406 1:232057385-232057407 CTCCTCTCCAGGATCCCCGTGGG + Intergenic
923437188 1:233978570-233978592 CTGCAATCCAGGATCCCTGTGGG + Intronic
923809290 1:237294774-237294796 CTGCAATCCCCAATACCTGTGGG - Intronic
1063470611 10:6281757-6281779 CTGCACTCCAGGATCCTCCTAGG + Intergenic
1063792062 10:9462485-9462507 TTGCAAACCAGGATAACTGTGGG - Intergenic
1064202888 10:13299705-13299727 CTGCCCTCCGGGATCCCTGGGGG - Intronic
1064928216 10:20593815-20593837 CAGCATTCCAAGATTCCTGTGGG + Intergenic
1067328559 10:45292981-45293003 CAGCCTTCCAGGATCCCTCTAGG + Intergenic
1069586145 10:69603953-69603975 CTCCTATCCTGGATCCCTGAAGG - Intergenic
1069913991 10:71775981-71776003 CTGAATTCCAGCCTCCCTGTTGG + Intronic
1074142116 10:110682219-110682241 ATGCAATCCAGGATCCCACCTGG + Intronic
1074183537 10:111082753-111082775 CTTTAAGCCAAGATCCCTGTGGG - Intergenic
1080070463 11:28077946-28077968 CTGCAATCCTGTATCCTTCTGGG + Intronic
1081079545 11:38723819-38723841 CTGTAATCCAAGCTCTCTGTGGG + Intergenic
1085300328 11:75454631-75454653 CTGCATTAAAGCATCCCTGTTGG - Intronic
1086243227 11:84720901-84720923 CTGCAATCCAGAGTCACTGTGGG + Intronic
1088897229 11:114087771-114087793 CTGGAATCTAGGATCCCGGATGG - Intronic
1090904120 11:131058968-131058990 CTGAATACCAGGATCACTGTGGG + Intergenic
1093920099 12:24849844-24849866 CTTTAATCCAGTGTCCCTGTGGG - Exonic
1104454576 12:128900595-128900617 CTGGAAACCAGGATGCCTGTTGG - Intronic
1113458841 13:110467716-110467738 CTGCACTCCAGGGTCTCCGTGGG + Intronic
1118380920 14:65216935-65216957 CTGGAACCCAGGCACCCTGTGGG + Intergenic
1119578557 14:75752326-75752348 CTGTACTGCAGGATCCGTGTTGG + Intronic
1121523310 14:94600911-94600933 CAGGAATCCAGGATTGCTGTTGG + Intronic
1122550639 14:102547395-102547417 CTGCAATCAAGGGTCCCACTGGG + Intergenic
1123904871 15:24911453-24911475 GTGCAACCCAAGATGCCTGTGGG + Intronic
1127550658 15:60034520-60034542 ATGCAAACCTGGAGCCCTGTGGG + Intronic
1129672821 15:77616552-77616574 CAGCAATCCAGGAACCCCATGGG - Intronic
1130363265 15:83209476-83209498 CTACAGTCCAGCCTCCCTGTGGG + Intergenic
1132120721 15:99173047-99173069 CTGGAAACCAGAATCCCTCTAGG + Intronic
1133013776 16:2929623-2929645 CTGCACTCCAGGTTCCTTGCTGG + Exonic
1133206802 16:4238969-4238991 GTGCATTCCAGGCTCACTGTGGG + Intronic
1134483497 16:14638319-14638341 GTGCAATCATGGATCACTGTGGG - Intronic
1140562618 16:76000691-76000713 CTGCAATCCAGGTAGCCTGGTGG + Intergenic
1140736130 16:77899343-77899365 CTGCAAATCAGGATGCCTGACGG - Intronic
1142627988 17:1204095-1204117 GTGGAATCCAGGAGCCCTGGTGG - Intronic
1143288889 17:5813617-5813639 ATGTAATCCAGGTTGCCTGTTGG + Intronic
1143377755 17:6477421-6477443 CAGCCATCCAGCATCCCAGTGGG - Intronic
1147446277 17:40477134-40477156 CTGCAAGCCAGGAGCCCCGTGGG + Exonic
1147464199 17:40598226-40598248 CTGCAGGCCAGGCTCCCTGGTGG + Intergenic
1148024098 17:44573702-44573724 CAGGAATCCAGGATCCCTGGAGG - Intergenic
1149265701 17:54925370-54925392 CTGCCAGCCAGCATGCCTGTTGG + Intronic
1151133933 17:71926897-71926919 CTGTAATCCAGGATTCCAGTGGG - Intergenic
1151529410 17:74695072-74695094 CTGCACTCCAGGCTCCTTCTTGG - Exonic
1152298797 17:79483659-79483681 CTGGAATGCAGGCTCCCTGAGGG + Intronic
1152355754 17:79806425-79806447 CTGCAAGACAGGATCTCTGGCGG + Intergenic
1152397348 17:80041830-80041852 CTGGAATCCTGCATCCCTGGTGG - Intronic
1152716914 17:81904673-81904695 CTGCAAACCAGGCACCTTGTAGG + Exonic
1154210982 18:12377859-12377881 CTGCGCTCTAGGAACCCTGTCGG + Intergenic
1157494190 18:48143480-48143502 GTGCAAGCCAGGATCCCTGAGGG + Intronic
1158998176 18:62945173-62945195 CTGCAATTCATGATCGTTGTTGG - Exonic
1159436518 18:68425244-68425266 CTGCAGTCCAGGATTCGTTTGGG - Intergenic
1159873615 18:73786420-73786442 CTGAAAACCAGCATCTCTGTAGG - Intergenic
1160876289 19:1297697-1297719 CTGCACTCCAGGATGCTTCTGGG + Intronic
1161297769 19:3528252-3528274 CAGCAACCCAGTCTCCCTGTAGG - Intronic
1161961926 19:7527978-7528000 CTGGAACTCAGGAGCCCTGTGGG - Intronic
1162956405 19:14101011-14101033 CAGCGATCCTGGCTCCCTGTAGG + Intronic
1163653287 19:18531455-18531477 CTGAAATCCAGGACCCCAGTGGG - Intergenic
1167333188 19:48868827-48868849 CTGCACTCCAGGGCCCCCGTGGG + Intergenic
925051339 2:818123-818145 CTGCTCTCCAGAATCCCTGGGGG - Intergenic
925421405 2:3715806-3715828 CTGAAATGCAGGCTCCCTGAGGG - Intronic
926944459 2:18171640-18171662 CTGCATACCAGGAACCCTCTTGG + Intronic
929007441 2:37409828-37409850 CTGAAATCCAGGCTCACTGCTGG - Intergenic
930454714 2:51592445-51592467 CAGCACCCCAGGATCACTGTGGG - Intergenic
931157844 2:59655552-59655574 CTGCAAACTTGTATCCCTGTGGG - Intergenic
932277416 2:70462049-70462071 CTAGAATCCTGGCTCCCTGTGGG + Intronic
932961115 2:76413790-76413812 CTGCAATGCAGTCTCACTGTGGG - Intergenic
933774107 2:85761517-85761539 CTGTGATCCAGGGTCACTGTAGG - Intronic
937047320 2:118858705-118858727 ATGCAAACGAAGATCCCTGTTGG - Intergenic
938182376 2:129194620-129194642 TTGCAATCAAGGAAACCTGTCGG + Intergenic
939006802 2:136798089-136798111 TTACAATCAAGGATGCCTGTTGG + Intronic
946462958 2:219886414-219886436 CTGCAGTCTAGGCTCCATGTGGG - Intergenic
948270574 2:236670372-236670394 CTCCAAGCCAGGCTCCTTGTGGG - Intergenic
948284039 2:236770158-236770180 CTGCTATCCTGGATTCCTCTGGG - Intergenic
948284069 2:236770380-236770402 CTGCCATCTTGGATCCCTCTGGG - Intergenic
948727874 2:239945840-239945862 TTGCAGTCCCGGAGCCCTGTGGG - Intronic
1169046268 20:2536687-2536709 CTGCTGCCCAGGAACCCTGTGGG - Intronic
1171206595 20:23286538-23286560 CTGCCACCCAGGAGCCCTGCCGG - Intergenic
1172997698 20:39083339-39083361 CTGCTCTGCAGGGTCCCTGTGGG - Intergenic
1173730540 20:45325426-45325448 CTGCAACCCAGGGTCCCAGCTGG - Exonic
1175372434 20:58500951-58500973 CTGCTACCCAGGCTCCCTGAGGG + Intronic
1181185685 22:21102061-21102083 CTACAATGCAGGATGTCTGTGGG + Intergenic
1184689195 22:46109830-46109852 CTGCACTCCAGGATGCCCGGTGG - Intronic
950107131 3:10395306-10395328 CTCCAGGCCAGGATCCATGTGGG - Intronic
956594115 3:70947895-70947917 CTGGGATCCAGCATCCCTGGAGG - Intergenic
958764837 3:98354313-98354335 CTGCATTCCATGATTCATGTAGG + Exonic
958774886 3:98470036-98470058 CTGCATTCCATGATTCATGTAGG + Exonic
958777060 3:98498140-98498162 CTGCATTCCATGATTCATGTAGG + Exonic
965597358 3:170421992-170422014 CTGCCCTCCAGGAACCCTGAGGG + Intronic
968021051 3:195389849-195389871 CTGCACTTCAGGATCCGCGTTGG - Intronic
969138131 4:5047663-5047685 CTGTCATCCAGGAGCCCTGCAGG - Intergenic
969393863 4:6908588-6908610 CTGCCAACCAGGAGCCCTGAGGG - Intergenic
973711292 4:53632548-53632570 GTGCAATTCATGTTCCCTGTCGG + Intronic
974412143 4:61555621-61555643 CTGAGATCCAAGATCCCTCTCGG - Intronic
983929057 4:173433586-173433608 CTGCAGTCCAGAGTCCCTATAGG - Intergenic
989967102 5:50477301-50477323 CTGAAATCCAGACTGCCTGTTGG - Intergenic
991460078 5:66849014-66849036 CTGCAAAACAGGAAACCTGTTGG + Intronic
992010436 5:72520588-72520610 CTGCAAGCCAGGAAAACTGTGGG + Intergenic
992679219 5:79136428-79136450 CTGACAACCAGGATCCATGTGGG - Intronic
993363214 5:87003297-87003319 CTGCAACTCAGCCTCCCTGTTGG - Intergenic
995793346 5:115916969-115916991 CTGAAATGCAGGAACCCTTTTGG + Intergenic
995946260 5:117650237-117650259 CAGAAATCCAGAATCCCTGGGGG + Intergenic
997406708 5:133654787-133654809 CTGAACTCGTGGATCCCTGTGGG - Intergenic
997445127 5:133934927-133934949 ATGAAACCCAGGTTCCCTGTGGG - Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1002330111 5:178435183-178435205 CTGGAGTCCGGGACCCCTGTGGG + Intronic
1002330471 5:178437231-178437253 CTGGAGCCCAGGACCCCTGTGGG - Intronic
1003427931 6:6009554-6009576 CTGCAGTCCAGGCTCCATGCAGG + Intergenic
1003520738 6:6856531-6856553 CTGCGACACAGGATCTCTGTTGG - Intergenic
1011652140 6:89516353-89516375 CTGAGAACCAGGATCCCTGATGG - Intronic
1013195063 6:107837644-107837666 CTGCACTCCAGAATCCCTGAGGG - Intergenic
1021367665 7:19800953-19800975 TTGCTATCCAGTACCCCTGTAGG + Intergenic
1021563124 7:21988526-21988548 CTGTCATCCTGGATCCCTGATGG - Intergenic
1023547714 7:41336297-41336319 TTGTAAGCCAGGATCCCTTTGGG - Intergenic
1027180987 7:75939137-75939159 CTGCACTCCAGGAACTGTGTGGG - Intronic
1031485646 7:122320312-122320334 CTGCAATCGAAAGTCCCTGTAGG + Exonic
1031853034 7:126888636-126888658 CTGGAGTCTAGGATCTCTGTTGG + Intronic
1033606243 7:142930169-142930191 CTCCAATCCAGGAGCCCTGGGGG - Exonic
1034229821 7:149514187-149514209 ATAAAATCCAGCATCCCTGTAGG - Intergenic
1041642159 8:60214748-60214770 CTGCATTCCATGTTTCCTGTGGG - Intronic
1042512196 8:69623846-69623868 CTCCACTCCAGGATCCCTTCTGG + Intronic
1047314189 8:123717142-123717164 ATTCAAACCAGGATTCCTGTGGG - Intronic
1047896911 8:129376357-129376379 CTACTATACTGGATCCCTGTTGG - Intergenic
1048558902 8:135511166-135511188 CTGGAATCCTGAATCTCTGTTGG + Intronic
1049033135 8:140051765-140051787 TTGTAGTCCTGGATCCCTGTGGG + Intronic
1049659565 8:143813715-143813737 CTCCCATCCAGGCTCCCTGATGG - Exonic
1050797542 9:9562889-9562911 CTGGAATCCAAGCTCCATGTGGG + Intronic
1051235084 9:14991100-14991122 CTGCAAACCAGGATCACCGAGGG - Intergenic
1052738509 9:32370278-32370300 CCGCATTCCTGCATCCCTGTAGG - Intergenic
1054813666 9:69454756-69454778 CAGGGATCGAGGATCCCTGTAGG - Intronic
1056665726 9:88579283-88579305 CTGCAATCCGGAATGCCTGAAGG + Intronic
1059629582 9:116106378-116106400 CAGCAATTCAGGAAGCCTGTGGG - Intergenic
1187433994 X:19250161-19250183 CTGCCATCCCGATTCCCTGTAGG - Intergenic
1191062882 X:56318250-56318272 CTGCAAGCCAGCCTCCATGTTGG + Intergenic
1192669734 X:73127345-73127367 CAGAAATCGGGGATCCCTGTAGG + Exonic
1195121821 X:101762204-101762226 CTGCACTCCACAATCCCTTTGGG - Intergenic
1195991294 X:110685030-110685052 CTGCCCTCCAGTATCCCAGTTGG - Intronic
1197137362 X:123077738-123077760 CTGCAATGCAGGATTCCTGTAGG - Intergenic
1199967846 X:152834588-152834610 CAGCAAAGCAGGAGCCCTGTAGG - Intronic
1202125641 Y:21566752-21566774 CTGTCTTCCATGATCCCTGTTGG + Intergenic
1202153367 Y:21862640-21862662 CTGTCTTCCATGATCCCTGTTGG - Intergenic