ID: 923439903

View in Genome Browser
Species Human (GRCh38)
Location 1:234007402-234007424
Sequence CCTTCTCCGCAGGAGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923439903_923439914 23 Left 923439903 1:234007402-234007424 CCAAGTTCCTCCTGCGGAGAAGG 0: 1
1: 0
2: 3
3: 14
4: 159
Right 923439914 1:234007448-234007470 GCATGGCTGCAGCAGAATGAGGG 0: 2
1: 1
2: 6
3: 41
4: 311
923439903_923439915 28 Left 923439903 1:234007402-234007424 CCAAGTTCCTCCTGCGGAGAAGG 0: 1
1: 0
2: 3
3: 14
4: 159
Right 923439915 1:234007453-234007475 GCTGCAGCAGAATGAGGGAGTGG 0: 2
1: 2
2: 22
3: 116
4: 648
923439903_923439911 6 Left 923439903 1:234007402-234007424 CCAAGTTCCTCCTGCGGAGAAGG 0: 1
1: 0
2: 3
3: 14
4: 159
Right 923439911 1:234007431-234007453 TGTGGGTGCAGAAGCCAGCATGG 0: 1
1: 0
2: 3
3: 38
4: 431
923439903_923439913 22 Left 923439903 1:234007402-234007424 CCAAGTTCCTCCTGCGGAGAAGG 0: 1
1: 0
2: 3
3: 14
4: 159
Right 923439913 1:234007447-234007469 AGCATGGCTGCAGCAGAATGAGG 0: 2
1: 0
2: 8
3: 40
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923439903 Original CRISPR CCTTCTCCGCAGGAGGAACT TGG (reversed) Intronic
902602881 1:17551979-17552001 GCTTCTGGGCAGGAGGAGCTGGG + Intronic
903926383 1:26833675-26833697 ACTTCTCAGCAGGAAGAGCTGGG - Intronic
907137493 1:52153598-52153620 CCTCATCCTCAGGAGGAAGTAGG - Intronic
910108743 1:83659390-83659412 CCTTCTAAGCAGAAGGCACTGGG + Intergenic
910849227 1:91634974-91634996 CCTTCTCAGCAGGAAGAACTTGG + Intergenic
910939202 1:92515034-92515056 CCTTCTCCCCAGGGGGAGTTGGG - Intronic
911709765 1:101057088-101057110 CCTTCTCAGCTGGAGAAAATAGG + Intergenic
913449073 1:118980091-118980113 GTTTCGCCGCAGAAGGAACTGGG - Intronic
914449010 1:147774056-147774078 CCTTCTACGCATCAGGCACTGGG + Intergenic
915158222 1:153896046-153896068 CCAGCTCCTCAGGAGGAAGTGGG + Intronic
916218535 1:162420102-162420124 CATTCTCCACAGGAGGAACCTGG + Intergenic
916351939 1:163860446-163860468 CCTTCTGAGCATGAGGAACTAGG + Intergenic
923316672 1:232787006-232787028 CCTCCTCCGGAGGTGGAAGTGGG + Intergenic
923439903 1:234007402-234007424 CCTTCTCCGCAGGAGGAACTTGG - Intronic
924195220 1:241600193-241600215 CCTTATCCCAAAGAGGAACTGGG - Intronic
1067448385 10:46366895-46366917 CCTTCTCCCCAGCAGGCATTTGG + Intergenic
1067588990 10:47493871-47493893 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1067636115 10:48001962-48001984 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1068492347 10:57739341-57739363 GCCTCTCAGCAGGAAGAACTTGG - Intergenic
1069746162 10:70716332-70716354 CTCTCTCCCCAAGAGGAACTGGG - Intronic
1070132675 10:73665967-73665989 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1071609009 10:87018107-87018129 CCTTCTCCCCAGCAGGCATTTGG + Intergenic
1073068501 10:100778727-100778749 CCTTCTCCCCAGGATGTACAGGG + Intronic
1076113326 10:127877782-127877804 CATTCCCCTCAGGAGGGACTGGG - Intergenic
1076114634 10:127886737-127886759 CCTGCTCCTCAAGTGGAACTGGG + Intronic
1076276049 10:129199750-129199772 CCTTCTCTGAAGGAGGGAGTGGG - Intergenic
1076310028 10:129498864-129498886 CCTTCTCAGTAGGGGGAGCTAGG + Intronic
1080227273 11:29975062-29975084 CCTCCTCCCCAGGCAGAACTAGG + Intergenic
1080878988 11:36301576-36301598 CCTTCCCAGCTGGAGGAAGTGGG + Intronic
1083655163 11:64225999-64226021 CCCTCTCTGCAGCAGGGACTTGG - Intronic
1084301198 11:68253807-68253829 CCTTATCCTCCCGAGGAACTGGG + Intergenic
1084316070 11:68346642-68346664 CCATCTGCGCAGGAGGACCCAGG + Intronic
1084331915 11:68435582-68435604 CCCTCTCCGCAGTAGCAAATGGG - Intronic
1084888367 11:72224641-72224663 CCGTCCCCGCAGGAGGAGCTGGG + Intronic
1085682894 11:78594840-78594862 CGTTATCTGCAGGAGCAACTGGG - Intergenic
1086970178 11:93073023-93073045 TGTTCTCTGCAGGAGTAACTGGG - Intergenic
1089053823 11:115568251-115568273 CATTCTTCGCAGGAGGAATAGGG - Intergenic
1091484257 12:868646-868668 CCTTCTCCTGAAGAGGAGCTTGG - Intronic
1097225849 12:57476444-57476466 CTGTCCCCGCAGGAAGAACTGGG - Exonic
1099131363 12:78836335-78836357 CCTTCACAGCAAGAGGAACCAGG + Intergenic
1102192298 12:110997940-110997962 CGTTATCCACAGGAGGAAATGGG - Intergenic
1102600476 12:114026007-114026029 GCTGCTCCCCAGGAGGTACTGGG - Intergenic
1104994033 12:132643024-132643046 CCCCCTGCGCAGGAGGAAGTGGG + Intronic
1105067120 12:133210415-133210437 CCTTCTCCTCAGGACCAACCTGG - Intergenic
1105296819 13:19095079-19095101 CCTTTTTTGAAGGAGGAACTGGG - Intergenic
1106022725 13:25930386-25930408 CCTAATGCACAGGAGGAACTGGG - Intronic
1107265366 13:38546823-38546845 CCTTCTCAGCAGGAAGAACTAGG - Intergenic
1109952580 13:69518426-69518448 CCTTCTCAGCAGTGGTAACTGGG - Intergenic
1112996346 13:105578861-105578883 CATTCTCCCCAGTAGGATCTGGG + Intergenic
1113672979 13:112187620-112187642 CCTCCTCTGCAGGGGGACCTCGG + Intergenic
1114178860 14:20348122-20348144 CCTTGTCCTCATGAGGCACTGGG + Intronic
1115645541 14:35366484-35366506 CCTTCTCCCCTGGAGTAAGTGGG - Intergenic
1119726287 14:76923696-76923718 CTTTCTCTGAGGGAGGAACTAGG - Intergenic
1125378019 15:39054306-39054328 CCTTCTCTCCTGGAAGAACTTGG - Intergenic
1125541021 15:40470382-40470404 CCTTCTCCTCATGAGGCAGTGGG - Intergenic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1129171646 15:73811697-73811719 CCTTCTCCGCAGGTAGCTCTGGG + Intergenic
1133267338 16:4593119-4593141 CCTTCCCAGCAGGAGGAAGGAGG - Intronic
1133738552 16:8633777-8633799 CCTTCTCTGCATGAGGCACTGGG - Intronic
1134872550 16:17665203-17665225 TCTTATCTGCAGGAGTAACTAGG - Intergenic
1138380885 16:56601549-56601571 CCTTCTCCCCAGGAGGCTGTGGG - Intergenic
1140261112 16:73380832-73380854 CCATCTCTACAAGAGGAACTTGG + Intergenic
1140664030 16:77212562-77212584 CCTTCTCCGCAGGCTGAAGGCGG + Exonic
1141652133 16:85398361-85398383 CCTCCTGCTCAGGAGGGACTGGG - Intergenic
1143299216 17:5897206-5897228 CCTTCTCAGCAGTGGGAACGTGG - Intronic
1144213950 17:13038334-13038356 CCTACTCCTCAGGGTGAACTGGG - Intergenic
1144959343 17:19036070-19036092 CTCTCTCCGCAGGTGGTACTCGG - Exonic
1144975816 17:19138454-19138476 CTCTCTCCGCAGGTGGTACTCGG + Exonic
1146234664 17:31146950-31146972 CCTTTTTTGAAGGAGGAACTGGG + Intronic
1149679575 17:58495917-58495939 CCTTCTGCCCAGGATGAGCTGGG - Exonic
1150471982 17:65445243-65445265 GCTTCTCAGCAACAGGAACTGGG - Intergenic
1153532014 18:6056410-6056432 CCTGCTAGGCAGGAGGCACTGGG + Intronic
1153602414 18:6794440-6794462 CATCCTCACCAGGAGGAACTTGG + Intronic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1160015124 18:75134260-75134282 CTTTCTCCGCAGGAGGCCCTGGG - Intergenic
1160108685 18:76004673-76004695 CCTTCTCACCAGGAGGATCCTGG + Intergenic
1160521249 18:79509385-79509407 CCTTCACTGTAGGAGGAGCTGGG + Intronic
1161767569 19:6215910-6215932 CCTTTTCCCCAGGAGGCACAGGG - Intronic
1161795393 19:6383485-6383507 CCTGGCCCGCAGGAGGAACAAGG - Exonic
1162381003 19:10331948-10331970 CTTTATCAGCAGGAGGAAATTGG - Intronic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1164648615 19:29876225-29876247 CCTTCTGGGCAGGTGGACCTGGG - Intergenic
1165726086 19:38113973-38113995 ACTTCCCAGCAGGAGGGACTGGG - Intronic
1167142058 19:47658514-47658536 CCTTAGCCTCAGGAGTAACTGGG - Intronic
1167396552 19:49233172-49233194 CTTTGACAGCAGGAGGAACTGGG + Intergenic
1167412854 19:49355328-49355350 CCTTCTCTGCAGGCCAAACTGGG - Exonic
1168719220 19:58545582-58545604 GCATCTGCGCAGGAGGAGCTTGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925687647 2:6489985-6490007 CCTTCCCAGAATGAGGAACTAGG + Intergenic
926020580 2:9491624-9491646 CATGCTCTGCTGGAGGAACTGGG + Intronic
927934994 2:27071453-27071475 TCTTCTCCGCAGGATGATCACGG - Exonic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
936642337 2:114328648-114328670 CCTTCTCCGAAAAAGGATCTGGG + Intergenic
947809063 2:232988603-232988625 CCATCTCCGCTGCAGGAATTTGG + Intronic
947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG + Intronic
948513235 2:238487291-238487313 CTTCCTGCGCAGGAGGCACTGGG + Intergenic
1169334708 20:4746782-4746804 CCTTTTCAGCAGGGGCAACTGGG - Intergenic
1171013527 20:21521572-21521594 GCTTCTCCTCAGACGGAACTGGG - Intergenic
1171217695 20:23363698-23363720 CCTTCTTCAGAGGAGGAAATGGG + Intronic
1172155073 20:32818765-32818787 CCTTGGCTGAAGGAGGAACTGGG - Intergenic
1173447927 20:43137142-43137164 CCTTCTCCTCAGGAGGAGGTTGG - Intronic
1176052781 20:63129293-63129315 CCTGCTCCTCAGGAGGGTCTGGG + Intergenic
1178933230 21:36837849-36837871 CCCTCTCCGCTGTAAGAACTTGG - Intronic
1179288307 21:39996840-39996862 CCTTCTCTGCAGGAGCACCGTGG - Intergenic
1179571605 21:42281906-42281928 CCTTCTCCGTATGGGGCACTGGG + Intronic
1179981981 21:44900465-44900487 CCTTCTTCTCAGGAGGAAATCGG - Exonic
1180663151 22:17486605-17486627 CATTCTCCCCAGGAAAAACTAGG + Intronic
1182115438 22:27753698-27753720 CCTTCTCCCCAGGAAGCCCTGGG - Intronic
1183102477 22:35592480-35592502 CCTCCTCCTCTGGAGGCACTGGG + Intergenic
949760681 3:7467057-7467079 CCTTCTCAGAAGGAGGAAGAGGG - Intronic
950116386 3:10452803-10452825 CCTTCTGTCCAGAAGGAACTTGG + Intronic
950456066 3:13093441-13093463 CTTCCTCCACAGGAGGAGCTGGG + Intergenic
953333106 3:42071165-42071187 CTCACTCCGTAGGAGGAACTTGG - Intronic
953381979 3:42478860-42478882 CCATCTCCTGAGGAGGGACTGGG - Intergenic
953770925 3:45778129-45778151 CCTTCTCAGCAGGAGCACCTGGG - Intronic
959587599 3:108039602-108039624 TCTTCTCCTCAGAAGCAACTGGG - Intergenic
961891773 3:130136454-130136476 GCTTCTCCGCTGGGAGAACTGGG - Intergenic
963795691 3:149628582-149628604 CCTTGTCCGCAGGATAGACTAGG + Intronic
967917192 3:194587511-194587533 CCTACCCCTCAGGAGAAACTGGG + Intergenic
970322199 4:14886001-14886023 CCCTCTCAGAAGGAGGATCTAGG - Intergenic
972562170 4:40238429-40238451 AGTTCTCCGGAGGAGGAAATGGG + Intronic
972627016 4:40809243-40809265 CCTTCCCTGCAGGGGAAACTTGG - Exonic
972891087 4:43557290-43557312 CCTTCTTCACAGGAGCATCTAGG + Intergenic
973606008 4:52588426-52588448 CCTTCTCTGCTGGAGCAAATTGG + Intergenic
976619848 4:87116456-87116478 CCTTCTCAGCAGGAGAGAGTTGG - Intronic
981815054 4:148821160-148821182 CCTACTACACAGCAGGAACTAGG - Intergenic
982262786 4:153509608-153509630 CCTCCTCCTCAGGAGTAGCTGGG - Intronic
985272510 4:188207530-188207552 GCTGCTGCGCATGAGGAACTGGG + Intergenic
985287748 4:188354302-188354324 TCTTCTCAGCAGGAGGAAGTTGG + Intergenic
986500154 5:8390305-8390327 CCTTCTGCACAGTAAGAACTGGG - Intergenic
989086936 5:37685832-37685854 CCTGCTCCCCAGGAGTCACTGGG + Intronic
991440420 5:66641573-66641595 ACTTCCCAGCAAGAGGAACTAGG + Intronic
992219899 5:74561441-74561463 CTTTCTCAGCAGGATGATCTGGG - Intergenic
992417468 5:76565665-76565687 TCTTATCCACAGTAGGAACTTGG + Intronic
994386753 5:99142140-99142162 CCTTCTCCTGAGGAGAAACTGGG + Intergenic
995086721 5:108119363-108119385 TATTCTCCCCAGGAGGAACCAGG + Intronic
996874036 5:128222151-128222173 CCCTCTCCCCAGGAGCACCTGGG - Intergenic
999310252 5:150547256-150547278 CATTCTCCCCAGGAGGACCTGGG + Intronic
1000328353 5:160188649-160188671 CCTTCTCCGCAGGGAGAAGCCGG - Intronic
1003298886 6:4858813-4858835 CTTTTTCCAGAGGAGGAACTGGG - Intronic
1004222919 6:13761897-13761919 CCAACTCCCCAGGAGGAAATTGG - Intergenic
1005268760 6:24140912-24140934 CCTTTCCAGCAGCAGGAACTGGG + Intronic
1006154372 6:32006349-32006371 GCTTGTCTGCAGGAGGAGCTGGG - Intergenic
1006471882 6:34234257-34234279 CCTACTCTGTAGCAGGAACTGGG - Intergenic
1014817916 6:125955157-125955179 TCTCCTCCTCAGGGGGAACTGGG + Intergenic
1018340846 6:162849420-162849442 CTTTCTCAGCAGCAGGCACTGGG - Intronic
1019474207 7:1236275-1236297 CCTTGTCCGCAGGGCGACCTGGG - Exonic
1022459720 7:30594103-30594125 CCCTTTGGGCAGGAGGAACTGGG + Intergenic
1023848944 7:44139909-44139931 GGTCCCCCGCAGGAGGAACTGGG + Intronic
1024323898 7:48093825-48093847 TCTTCTCCCCAGGAAGAATTGGG - Intronic
1024534413 7:50418308-50418330 CCCTCTCCCCACGAGGAGCTGGG - Intergenic
1026848661 7:73711642-73711664 CCTGCCCAGGAGGAGGAACTGGG - Intronic
1028110143 7:86930659-86930681 CCTTCTTCGAAGGAGGCATTAGG - Intronic
1033608109 7:142942169-142942191 CCTCCTCTCCTGGAGGAACTTGG + Intronic
1035324740 7:158057666-158057688 CCTTTTCCTCATGAGGAAGTGGG - Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1038142883 8:24865514-24865536 CCTTCCCTGAAGGGGGAACTCGG + Intergenic
1039737206 8:40345541-40345563 TTTTCTCAGCAGGAAGAACTGGG - Intergenic
1042314809 8:67414287-67414309 CCATTTCCGCAGCAGCAACTTGG + Intergenic
1042403106 8:68372388-68372410 TCTTCTCAGCAGGAGGGACTGGG - Intronic
1048919590 8:139215828-139215850 CCTTCTCCTTAGGAAGAACAGGG - Intergenic
1049375808 8:142288534-142288556 CCTTCTGCCCAGGAGGACCCGGG - Intronic
1049391227 8:142372710-142372732 CCTTCTCAGGAGGAGGCCCTTGG - Intronic
1049483527 8:142839477-142839499 CCTCCACCGCAGGAGCAGCTGGG - Intronic
1052518713 9:29514989-29515011 CCTGCTCTGCAGGTGGAACCTGG + Intergenic
1053303627 9:36969059-36969081 CCTTCTGACAAGGAGGAACTTGG - Intronic
1053489193 9:38487087-38487109 CCTTCATCGGAGGAGGAGCTGGG + Intergenic
1056595936 9:88007563-88007585 CCTTCCCAGCAGGAGGGGCTGGG - Intergenic
1059851618 9:118347365-118347387 TCTTCTGCGGAGGATGAACTGGG - Intergenic
1061087194 9:128405983-128406005 CCTTCTCAGCAGCAGGAGCTGGG + Intergenic
1062396037 9:136353254-136353276 CCTCCTCCGCAGGAGAAACTGGG + Intronic
1192207210 X:69104577-69104599 CCTGCTCCACAGGAAGAAGTAGG - Intergenic
1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG + Intergenic
1195779430 X:108444672-108444694 CCCTCTCAGCAGGCAGAACTAGG + Intronic
1200070342 X:153526031-153526053 CCTTCCCCGAAGGAGGAAGCTGG + Intronic
1200392236 X:155956027-155956049 CCTTCTGCTCAGGAGGGACCTGG + Intergenic