ID: 923440107

View in Genome Browser
Species Human (GRCh38)
Location 1:234009782-234009804
Sequence CAATCTGCTGATAGTCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 1, 2: 12, 3: 104, 4: 475}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923440107_923440108 -3 Left 923440107 1:234009782-234009804 CCAATATGACTATCAGCAGATTG 0: 1
1: 1
2: 12
3: 104
4: 475
Right 923440108 1:234009802-234009824 TTGCTCAGCAGAACCCCTTCTGG 0: 1
1: 0
2: 2
3: 56
4: 358
923440107_923440113 12 Left 923440107 1:234009782-234009804 CCAATATGACTATCAGCAGATTG 0: 1
1: 1
2: 12
3: 104
4: 475
Right 923440113 1:234009817-234009839 CCTTCTGGCCAAGAGAGAGTGGG 0: 1
1: 0
2: 2
3: 32
4: 376
923440107_923440111 11 Left 923440107 1:234009782-234009804 CCAATATGACTATCAGCAGATTG 0: 1
1: 1
2: 12
3: 104
4: 475
Right 923440111 1:234009816-234009838 CCCTTCTGGCCAAGAGAGAGTGG 0: 1
1: 0
2: 2
3: 50
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923440107 Original CRISPR CAATCTGCTGATAGTCATAT TGG (reversed) Intronic
901189530 1:7399832-7399854 AAATCTGCTGATAGTTTAATGGG + Intronic
903205556 1:21779707-21779729 TCATCTGCTGATAGACATTTGGG - Intronic
904219138 1:28950718-28950740 CAATCTGCTCTTAATTATATGGG - Intronic
905002094 1:34680576-34680598 CTGTTTGCTGATAGTGATATGGG + Intergenic
906762605 1:48389559-48389581 GAATCTGCTGTTAGTCTAATGGG - Intronic
906870800 1:49478379-49478401 AAATCTGCTGCTAGACATATTGG - Intronic
908812328 1:67995675-67995697 CTATCTGCTGATAGTCATTTAGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
910774237 1:90859040-90859062 CTATTTGTTGACAGTCATATGGG - Intergenic
911154935 1:94628021-94628043 CAAACTGGTCATAGTCATTTAGG - Intergenic
911217791 1:95215050-95215072 AAATCTGCTGTTAGTCTGATGGG + Intronic
911313061 1:96320257-96320279 ACATCTGCTGATAGTCTAATGGG - Intergenic
911452585 1:98083799-98083821 AAGTCTGCTGTTTGTCATATGGG - Intergenic
911925141 1:103819651-103819673 AAATCTGCTGTTAGTCTGATGGG - Intergenic
912133169 1:106627124-106627146 AAATCTGCTGTTAGTCTAATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912277889 1:108279927-108279949 AAATCTACTGATAGTTGTATTGG + Intergenic
912290337 1:108414432-108414454 AAATCTACTGATAGTTGTATTGG - Intronic
912588499 1:110788803-110788825 AAATCTGCTGTTAGTCTAATGGG - Intergenic
912856587 1:113173655-113173677 AAATCTGCTGTTAGTCTGATGGG - Intergenic
912899065 1:113628770-113628792 AAGTCTGCTGTTAGACATATTGG + Intronic
915999782 1:160604613-160604635 GAATCTGCTGTTAATCTTATAGG + Intergenic
916341641 1:163743619-163743641 AAATCTGCTGGCAGACATATTGG + Intergenic
916453695 1:164948310-164948332 AAATCTGCTGATAGTCCTATGGG + Intergenic
917041756 1:170812518-170812540 CAATCTGCTGTTAGTCTGATGGG - Intergenic
917177952 1:172260182-172260204 AAATCTGCTGTTAGTCTGATGGG + Intronic
917768392 1:178248902-178248924 AAATCTGCTGTTAGTCTGATGGG + Intronic
918291765 1:183115384-183115406 CAATCTCCTGATGGTCACAAAGG - Intronic
918664394 1:187131405-187131427 AAATCTGCTGATAGTCTAATAGG - Intergenic
918675302 1:187277192-187277214 CAGTCTGCTGAAGGACATATCGG - Intergenic
919010046 1:191948431-191948453 AAATCTGCTCATCGTTATATGGG + Intergenic
919290915 1:195629236-195629258 GAATCTGCTGATAGTCATATAGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920664374 1:207950592-207950614 CAAGTTGCTTATAGTCTTATTGG + Intergenic
920800096 1:209178382-209178404 AAATCTGCTGATAGTCTTATAGG - Intergenic
921288657 1:213633326-213633348 AAATCTGCTGTTAGTCTGATGGG - Intergenic
922378463 1:224995405-224995427 AAATCTGCTGATTGTTATACTGG + Intronic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
923625359 1:235609258-235609280 CCATCTGCTGATAGACATTTGGG + Intronic
1062884008 10:1002771-1002793 AAATCTGCTGTTAGTCTAATGGG + Intronic
1062898513 10:1123593-1123615 CCATCTGCTGATGGACATGTGGG + Intronic
1065081732 10:22136163-22136185 CAATCTTGTGAGAGTCATAGTGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066514306 10:36139685-36139707 AAATCTGCTGCCAGACATATTGG + Intergenic
1066930002 10:41746310-41746332 CACTCTGCGGATGGTCATTTTGG + Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068038620 10:51793667-51793689 AAGTCTGCTGCTAGGCATATTGG - Intronic
1068183957 10:53561470-53561492 AAATCTGCTGTTAGTCTGATAGG - Intergenic
1068298859 10:55112675-55112697 TAACATGCTGATCGTCATATGGG - Intronic
1068340192 10:55691679-55691701 AAATCTGCTGATAATCTAATGGG + Intergenic
1068490518 10:57717850-57717872 GGATCTGCTGTTAGTCCTATGGG - Intergenic
1070454363 10:76596166-76596188 GAATCTGCTGTTAGTCTGATAGG + Intergenic
1071210984 10:83341735-83341757 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1071935338 10:90524554-90524576 AAGTCTGCTGCTAGACATATTGG + Intergenic
1072358774 10:94638712-94638734 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1072377101 10:94829027-94829049 AGATCTGCTGTTAGTCAGATGGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073602766 10:104863104-104863126 AAATCTGCTGAGAGACATACAGG + Intronic
1073661291 10:105479369-105479391 AGATCTGCTGTTAGTCTTATGGG + Intergenic
1073872599 10:107882072-107882094 AAATCTGCTGCCAGACATATTGG - Intergenic
1073960411 10:108920219-108920241 AAATCTGCTGTTAATCTTATAGG - Intergenic
1074409003 10:113208050-113208072 AAATATGCTGATAGTATTATGGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078743231 11:14088494-14088516 AGATCTGCTGTTAGTCTTATGGG + Intronic
1078981332 11:16538104-16538126 AGATCTGCTGTTAGTCTTATGGG - Intronic
1078985265 11:16588228-16588250 CACTCTGCTGATATCCATCTGGG - Intronic
1078992911 11:16667464-16667486 AAGTCTGCTGCTAGACATATTGG - Intronic
1078998542 11:16729357-16729379 AGATCTGCTGTTAGTCTTATGGG - Intronic
1079335964 11:19571031-19571053 TAATCTGTTGATAGACATTTGGG - Intronic
1079577986 11:22026723-22026745 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1079683108 11:23322736-23322758 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079935626 11:26612854-26612876 AAATCTGCTGATAGTCTAATAGG + Intronic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1081682231 11:45016158-45016180 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1082838511 11:57668678-57668700 CACTCTGCTGATACTTATTTTGG + Intronic
1082955074 11:58862167-58862189 AAATCTGCTGTTAGCCTTATTGG + Intronic
1083650019 11:64197569-64197591 CAATCTGTCGATAGTCTTCTCGG - Exonic
1084293157 11:68189873-68189895 CAATGTTCTGATTGTGATATGGG - Intronic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087178450 11:95118518-95118540 AAGTCTGCTGACAGGCATATTGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088036815 11:105327033-105327055 CCATCTGTTGATAGTCTTTTTGG - Intergenic
1089952149 11:122538231-122538253 AAATCTGCTGATAGTCTAATGGG - Intergenic
1090557418 11:127891419-127891441 CAATCTTCTGATATTAATGTGGG + Intergenic
1090749054 11:129730045-129730067 CAATTTGCTGAAAGTCAGATGGG - Intergenic
1090979516 11:131705259-131705281 AAATCTGCTGATAGTCCTACAGG - Intronic
1091083966 11:132702405-132702427 AAATCTGCTGATAGTTTTATGGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1092970838 12:13693204-13693226 CAATTAGCTGATGGTCAAATTGG + Intronic
1093599035 12:20999870-20999892 AAGTCTGCTGTTAGTCTTATAGG + Intergenic
1094258771 12:28466499-28466521 AAATCTGCTGCCAGACATATTGG - Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095167077 12:38986047-38986069 AAATCTGCTGATAGTTTTACAGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095500895 12:42837770-42837792 AAATCTGCTGTTAGTCTGATAGG + Intergenic
1096007034 12:48182065-48182087 CATTCTGCTGCTGGTCATTTAGG + Intergenic
1096036018 12:48471339-48471361 CCATCTGCTGATGGACATTTAGG + Intergenic
1097679934 12:62639430-62639452 CATTCAGCTTCTAGTCATATTGG - Intergenic
1098129857 12:67338719-67338741 AAATCTGCTGTTAGTCTGATAGG + Intergenic
1098742136 12:74186214-74186236 AAATCTGCTGCTAGTCTTATTGG - Intergenic
1098960763 12:76737854-76737876 AAATCTGCTGTTAATCTTATAGG + Intergenic
1099430633 12:82580282-82580304 AAATCTGTTGATAGTCTTATGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100683776 12:96962002-96962024 AAATCTGCTGATAATCTAATAGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106462751 13:29987513-29987535 AAATCTGCTGTTAGTCTAATTGG + Intergenic
1106855260 13:33845134-33845156 AAATCTGCTGCCAGACATATTGG + Intronic
1108401142 13:50045294-50045316 CAAACTGCACATAGTTATATAGG - Intergenic
1108469619 13:50755052-50755074 AAATCTGCTGTTAGTCTGATAGG + Intronic
1108945460 13:56017855-56017877 AAATCTACTGCTAGCCATATGGG + Intergenic
1109150780 13:58844833-58844855 AAATCTGCTGTTAGTCTGATAGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109504737 13:63285623-63285645 AAATCTGCTGTTAGTCTTATAGG + Intergenic
1109635357 13:65108267-65108289 AGATCTGCTGTTAGTCTTATGGG + Intergenic
1109942339 13:69386399-69386421 CAGTCTGCTGCTAGGCCTATTGG - Intergenic
1110204569 13:72897078-72897100 GAATCTGCTGTTAATCTTATAGG - Intronic
1110985830 13:81967094-81967116 AAGTCTACTGCTAGTCATATTGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111365047 13:87232859-87232881 AAGTCTGCTGAAAGACATATGGG + Intergenic
1111602409 13:90491977-90491999 AATTCTGCTGATACTCATGTTGG + Intergenic
1111630028 13:90838679-90838701 TCATCTGCTGATAGACACATAGG + Intergenic
1113244052 13:108375295-108375317 AAGTCTGCTGATGGACATATTGG + Intergenic
1113344520 13:109463120-109463142 AAATATGCTGATACTTATATTGG + Intergenic
1113536833 13:111074488-111074510 AAATCTGCTGTTAGTCTAATGGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115295291 14:31819065-31819087 CTTTCTGCTGATACTAATATTGG + Intronic
1115940146 14:38600164-38600186 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1116044725 14:39730828-39730850 AAATCTGCTGTTAATCTTATAGG + Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116981225 14:51173107-51173129 TCATCTGCTGATAGACATTTAGG + Intergenic
1117112926 14:52476953-52476975 AAATCTGCTGTTAGTCTGATAGG - Intronic
1118549233 14:66931204-66931226 AAATCTGCTGCCAGACATATTGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120100305 14:80436906-80436928 AAATCTGCTGCCAGACATATTGG - Intergenic
1120151216 14:81036368-81036390 AAATCTGCTGATAGTCTAGTGGG - Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120697629 14:87661420-87661442 AAATCTGCTGCCAGACATATTGG - Intergenic
1121399255 14:93657680-93657702 AAATCTTCTGACAGTCACATCGG - Intronic
1122527575 14:102398938-102398960 AAATCTGCTTATAATCTTATTGG - Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123481014 15:20630855-20630877 AGATCTGCTGATAGTCTGATGGG - Intergenic
1123636997 15:22369510-22369532 AGATCTGCTGATAGTCTGATGGG + Intergenic
1123784119 15:23651765-23651787 GAATCTATTGTTAGTCATATAGG + Intergenic
1124091017 15:26600513-26600535 AAGTCTGCTGATAGTCGTATTGG - Intronic
1124557298 15:30737743-30737765 AAATCTGCTGTTAGTCTGATAGG - Intronic
1124810710 15:32935323-32935345 AAATCTTCTGATAGTCTTGTTGG + Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126552809 15:49952056-49952078 AGATCTGCTGATAGTCTGATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126941316 15:53769092-53769114 TCATCTGCTGATAGACACATAGG - Intergenic
1127410333 15:58699078-58699100 AAATCTGCTGTTAGTCTGATAGG - Intronic
1127611232 15:60639548-60639570 CAATCTCCTGAAAGGCACATTGG - Intronic
1127946651 15:63762273-63762295 CAATGTGCTGAAACTCAAATAGG + Intronic
1128954993 15:71931450-71931472 AAATCTGATGATAGTCTTGTGGG + Intronic
1129072322 15:72961640-72961662 CCTTCTGCTTATAGGCATATTGG - Intergenic
1129569380 15:76663471-76663493 CATTCTACTGATAGACATTTAGG - Intronic
1129581015 15:76809888-76809910 AAATCTACTGATAGTGTTATGGG - Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131276514 15:90986274-90986296 CATTCTGTTGATAGACATCTAGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1132334336 15:101035955-101035977 GAATCTGCTGTTAGTCTAATGGG + Intronic
1133413492 16:5587955-5587977 GAATCTGCTGATGGACATTTAGG - Intergenic
1133601261 16:7342452-7342474 CAATGAGCTGATTGTCAAATCGG - Intronic
1134897851 16:17905680-17905702 AAATCTGCTGTTAGTCTTATTGG - Intergenic
1135512236 16:23095626-23095648 CGATCTGCTGTTAGTCTGATGGG - Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139103630 16:63800295-63800317 AAATCTGCTGCTAGACATATTGG + Intergenic
1140325638 16:73999606-73999628 TCATCTGCTGATAGACATTTAGG + Intergenic
1140563783 16:76015519-76015541 AAATCTGCTGATAATTTTATGGG + Intergenic
1148408087 17:47438144-47438166 AAATCTGCTGTTAATCAGATAGG + Intronic
1149251427 17:54774561-54774583 CAATTTGCAGACAGTGATATGGG - Intergenic
1150462915 17:65367624-65367646 CCTTCTGCTGATGGGCATATAGG - Intergenic
1150540299 17:66089964-66089986 AAATCCGCTGCTAGTCTTATTGG - Intronic
1151299629 17:73214060-73214082 CAATCTTCTCAAAATCATATTGG - Intronic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1155317837 18:24590054-24590076 CACTCTGCTGATAGTCAGCAAGG + Intergenic
1156082854 18:33360346-33360368 CCATCTGTTGATAGTCATTTGGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156307448 18:35891140-35891162 TCATCTACTGATAGTCATACGGG + Intergenic
1158987965 18:62838022-62838044 GTATCTTTTGATAGTCATATTGG - Intronic
1159648263 18:70944925-70944947 AAGTCTGCTGCTAGACATATTGG - Intergenic
1160296159 18:77638874-77638896 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1162181094 19:8869264-8869286 TCATCTGCTGATGGACATATAGG - Intronic
1163495144 19:17642067-17642089 GAATTTGTTGATAGTCAGATGGG - Intronic
1163990059 19:20989963-20989985 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1164085473 19:21898310-21898332 TAATCTGCTGTTAGTCTGATGGG + Intergenic
1164946889 19:32302973-32302995 AAATCTGCTGATAACCTTATGGG + Intergenic
1166403724 19:42503888-42503910 TCATCTGCTGATAGACATTTGGG + Intergenic
1167834155 19:52052732-52052754 AGATCTGCTGTTAGTCACATGGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925442140 2:3897813-3897835 CAGTCTGCTGTTAGTCTGATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926185710 2:10689413-10689435 CAAACAGCTGATGGCCATATGGG + Intronic
927306901 2:21583931-21583953 ACATCTGCTGTTAGTCTTATGGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929103032 2:38335337-38335359 CTTTCTACTGATAGACATATGGG - Intronic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930230500 2:48839400-48839422 CAGTCTGCTGCCAGGCATATGGG + Intergenic
930294139 2:49532206-49532228 AAATCTGTTGAAAGTCTTATTGG - Intergenic
930732613 2:54742926-54742948 CAATCGGCTGATGGTAAAATTGG - Intronic
930801166 2:55443867-55443889 CGATCTGCTGTTAGTCTGATGGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931136145 2:59403421-59403443 AAATCTGCTGTTAATCTTATAGG - Intergenic
931161717 2:59700005-59700027 AAGTCTGCTGACAGGCATATTGG + Intergenic
931841447 2:66154137-66154159 AAATCTGCTGTTAGTCTTATGGG + Intergenic
932059474 2:68481463-68481485 AAATCTGCTGTTAGTCTAATGGG + Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933649257 2:84836406-84836428 AAATCTGCTGTTAATCCTATTGG + Intronic
933852516 2:86381853-86381875 AAATCTGCTGAAGGTCATGTTGG + Intergenic
934981147 2:98842804-98842826 CAACCTGCTGAAAGACATCTGGG + Intronic
935126128 2:100224385-100224407 CCATCTGCTTACAGTCAAATCGG + Intergenic
935310975 2:101783001-101783023 CATTCAGCTCATAGTCACATAGG + Intronic
935483426 2:103621880-103621902 AAATCTGCTGATAGCCATATTGG - Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936859779 2:117002896-117002918 AAATCTGCTGTTAGTCTGATGGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937739718 2:125335376-125335398 AAATCTGCTGCCAGACATATTGG - Intergenic
938231709 2:129667180-129667202 TCATCTGTTGATAGTCATTTAGG - Intergenic
938598096 2:132810147-132810169 AAATCTGCTGTTAATCTTATAGG + Intronic
939217007 2:139251333-139251355 CAAACTGCTGTCAGTCATCTGGG + Intergenic
939368864 2:141271518-141271540 GAGTCTGCTGTTATTCATATTGG - Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939841251 2:147189752-147189774 AAACCTGCTGATAATCATATGGG - Intergenic
939939024 2:148327200-148327222 AGATCTGCTGTTAGTCTTATGGG + Intronic
940131243 2:150385530-150385552 AAATCTGCTGCTAGTCTTATAGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940423536 2:153506702-153506724 AAATCTGCTGTTACTCTTATAGG + Intergenic
940592207 2:155743802-155743824 AAATCTACTGATAGTCATAATGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941256590 2:163239938-163239960 AAATCTACTGATAGTCATATAGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941583546 2:167329885-167329907 AAATCTGCTGTTAGTCTGATGGG + Intergenic
941742420 2:169048816-169048838 AAGTCTGCTGACAGACATATTGG - Intergenic
942125310 2:172818931-172818953 TATTCTGCTGTAAGTCATATAGG + Intronic
942778641 2:179614410-179614432 CAAACTGCTAAAAGTCATCTAGG - Intronic
944431920 2:199643402-199643424 AAATCTGCTGTTAATCTTATAGG + Intergenic
944602269 2:201314814-201314836 AAATCTGCTGTTAGTCTGATAGG - Intronic
944694464 2:202188701-202188723 GAATCTGCTGGGAGTCAAATAGG - Intronic
945371324 2:209021932-209021954 AAATCTGCTGTTAGTCTGATGGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946694147 2:222335086-222335108 AAATCTGCTGTTAGTCTGATGGG - Intergenic
947235881 2:227940347-227940369 AAATCTGCTGTTAATCAGATAGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947738404 2:232472393-232472415 AAGTATACTGATAGTCATATGGG + Intergenic
948448381 2:238051667-238051689 CATGCTGCTGATAGACATACCGG - Intronic
1169007362 20:2219666-2219688 AAATCTGCTGTCATTCATATTGG + Intergenic
1170199241 20:13724762-13724784 TAACATGCTGAAAGTCATATGGG + Intronic
1170240694 20:14163308-14163330 AAATCTGCTGTTAGTCTGATGGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170862988 20:20126578-20126600 AAATCTGCTGTTAGTCTGATAGG + Intronic
1172378919 20:34471884-34471906 CAATCTGATAATGTTCATATGGG - Intronic
1174468111 20:50732501-50732523 CAATCTGCTGATAATTACTTCGG + Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177299906 21:19229826-19229848 TAATTTGCTGGTACTCATATAGG + Intergenic
1177352613 21:19963886-19963908 AAATCCACTGATAGTTATATTGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177478071 21:21650425-21650447 CAATATGCTAATAGAAATATGGG + Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1179190185 21:39116741-39116763 TAATATGCTGGTAGACATATGGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1184055143 22:42042032-42042054 AAATCTGCTGATAGTCTCATAGG + Intronic
1184317211 22:43704156-43704178 AAATCTGCTGATAGTCATGTTGG - Intronic
949583545 3:5414297-5414319 AAATCTGCTGTTAGTCTAATGGG - Intergenic
949793909 3:7824737-7824759 AAATCTGCTGTTAGTCTAATTGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
950990403 3:17431687-17431709 AAATATGCTGATAGTTACATTGG + Intronic
951237530 3:20253044-20253066 CCATCTGCTGTTAGTCTGATGGG + Intergenic
951302528 3:21016257-21016279 AAATCTGCTGATAATCTAATAGG + Intergenic
952016946 3:28969174-28969196 AAATCTGCTGTTAGTCTGATGGG + Intergenic
952183087 3:30940127-30940149 TAATCTGCTGTTAATCAGATGGG + Intergenic
952775790 3:37044772-37044794 CAGTATGCTGTTAGCCATATAGG + Intronic
954588751 3:51761547-51761569 AAATATACTGATAGTCTTATGGG + Intergenic
956912732 3:73836082-73836104 ACATCTGCTGTTAGTCAGATGGG - Intergenic
957352954 3:79049676-79049698 AGATCTGCTGTTAGTCTTATGGG - Intronic
957735634 3:84198354-84198376 AAATTTGCTGTTAGTCTTATAGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958598512 3:96262013-96262035 AAATTTGCTGATAGTCTTATGGG - Intergenic
958950130 3:100407447-100407469 AAATCTGCTGCTAGGCATATTGG + Intronic
958957095 3:100476740-100476762 AAATCTGCTGTTAGTCTGATGGG + Intergenic
959078031 3:101771680-101771702 TAATCTGCTGATGGACATTTGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959491212 3:106990609-106990631 GTATCTGCTGATAGTCTAATGGG - Intergenic
959699666 3:109286806-109286828 CCAACTGCTGTTAGTCACATTGG - Intergenic
959717265 3:109446266-109446288 AAATCTGCTGCTAGTTGTATTGG - Intergenic
959987562 3:112592790-112592812 AAATCTGCTAATAATCTTATTGG + Intergenic
960185750 3:114636061-114636083 AAATTTGCTGACAGTCTTATGGG - Intronic
962025508 3:131542927-131542949 GAATGTGCTGATAGTCCTAAAGG + Intronic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962237808 3:133723135-133723157 AAATATGCTGATAGTCTGATAGG + Intergenic
962460349 3:135605992-135606014 CAATCCGCTGTTAGTCTGATGGG - Intergenic
962530317 3:136274484-136274506 AAATCTGCTGTTAGTCTGATTGG + Intronic
962547971 3:136456792-136456814 AAATCTACTGAAAGCCATATAGG - Intronic
962764760 3:138551147-138551169 AAATCTGCTGTTAATCTTATAGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963758590 3:149261288-149261310 AAATCTGCTGTTAGTCTGATGGG - Intergenic
964226610 3:154410009-154410031 AAATCTGCTGTTAATCTTATAGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964975943 3:162620927-162620949 AAGTCTGCTGCCAGTCATATTGG + Intergenic
965527059 3:169732083-169732105 AAATCTGCTGCCAGACATATTGG - Intergenic
965654860 3:170973663-170973685 AAATCTGCTGTTAGTCTGATGGG + Intergenic
966250712 3:177862204-177862226 AAGACTGCTGATAGTCATATTGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967553024 3:190822185-190822207 AATTCAGCTGTTAGTCATATTGG - Intergenic
967599933 3:191374592-191374614 CAATATTCTGATAGTTTTATTGG + Intronic
967779621 3:193421199-193421221 AAATCTGTTGATAGTCTAATGGG - Intronic
968379360 4:76808-76830 CAATTTGCTGATAACCTTATAGG + Intronic
968395879 4:237574-237596 CAATCTGCTGATAACCTTATAGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970885841 4:20986660-20986682 AAATCTGCTGATAGAAATAAAGG - Intronic
970896277 4:21107963-21107985 AAATCTGCTGTTAGTCTGATGGG + Intronic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
972155194 4:36152592-36152614 CAACCTGCTGATTATCATTTTGG - Intronic
972845265 4:42981787-42981809 AAATCTGCTGCTAGCCATGTTGG + Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
972934263 4:44112968-44112990 AAGTCTGCTGATAGACATATTGG + Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974023843 4:56714391-56714413 AGATCTGCTGATAGTCTGATGGG - Intergenic
974254384 4:59430272-59430294 AAATCTGCTGTTAGTCTGATGGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974848955 4:67382462-67382484 AAATCTGCTGTTAGTCTGATAGG - Intergenic
974951165 4:68584182-68584204 AAATCTGCTGTTAATCAAATAGG - Intronic
976861678 4:89673068-89673090 AAATCTGCTGTTAGTCTGATGGG - Intergenic
977045689 4:92065999-92066021 CAATCTGCTAATAGTTTTATAGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977941006 4:102859266-102859288 AAACCTGCTGAAAGTCTTATAGG + Intronic
978520213 4:109607743-109607765 AAGTCTGCTGCTAGACATATTGG + Intronic
978726522 4:111976307-111976329 AAATCTGCTGTTAATCAGATAGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979159859 4:117446683-117446705 AAATCTGCTGTTAGTCTAATAGG + Intergenic
979373441 4:119916195-119916217 AGATCTGCTGATAGTCTGATGGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
980503811 4:133689550-133689572 AAATCTGCTGTTAGTCTGATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
981958869 4:150511361-150511383 CCTTCTGCTTTTAGTCATATAGG + Intronic
982190784 4:152853515-152853537 AAATCCACTGATAGTCTTATGGG + Intronic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982825909 4:160003438-160003460 AAATCTGCTGATAGTTTGATGGG - Intergenic
983022070 4:162689696-162689718 CAATCTGTTGACAGGCACATAGG - Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983544761 4:168951777-168951799 AAATCTGCTGTTAGTCTGATAGG + Intronic
983588120 4:169377525-169377547 AAATCTGCTGTTAGTCTAATGGG - Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984054290 4:174907691-174907713 AAATCTGCTGTTAGTCTTATGGG + Intronic
985394589 4:189528878-189528900 AAATCTGCTGTTAGTCTGATAGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986049471 5:4075305-4075327 AAATCACCTGATAGTCATGTGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986928173 5:12784136-12784158 CTATCTCCAGATAGTCACATGGG - Intergenic
987615805 5:20273019-20273041 CTATATGCTGATAATCATTTAGG + Intronic
987681926 5:21146891-21146913 TAATCTGTTGATGGTCACATAGG + Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
989148623 5:38274487-38274509 AAGTCTGCTGTTAGGCATATTGG - Intronic
989194349 5:38701414-38701436 CGATCTGCTGTTAGTCTGATGGG - Intergenic
989303881 5:39928813-39928835 CATTCTGCTCATTGTCAAATTGG - Intergenic
989398027 5:40979348-40979370 CAATGTGATCATAGTCAAATGGG - Intronic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
989818275 5:45763140-45763162 AAATCTGCTGTTAGTCTAATAGG + Intergenic
989965000 5:50457351-50457373 AGATCTGCTGATAGTCTGATGGG + Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990853984 5:60241942-60241964 AAGTCTGCTGACAGACATATTGG - Intronic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991205434 5:64044060-64044082 AAATCTGCTGCCAGACATATTGG - Intergenic
991242516 5:64475836-64475858 AGATCTGCTGTTAGTCAAATGGG - Intergenic
991447245 5:66713305-66713327 TAATCTGCTGATGGTGATCTGGG + Intronic
991619089 5:68526433-68526455 CCATCTGCTGTTGGGCATATTGG - Intergenic
992885343 5:81153277-81153299 AAATCAGCTGATCGTCAGATAGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993672222 5:90775192-90775214 AAATCTGCTTTTAGTCACATAGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994793009 5:104256445-104256467 AAATCTGCTTATATTCTTATGGG + Intergenic
994940492 5:106317336-106317358 TATTCTGTTGATAGTTATATTGG + Intergenic
995068356 5:107888729-107888751 CATTCTGCTGATGGACATCTGGG + Intronic
995112036 5:108438958-108438980 AAATCTGCTGTTAGTCTGATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995359878 5:111283523-111283545 CAAGCTGCTGATAGCCATTGTGG + Intronic
996120527 5:119666762-119666784 AAATCTGCTGTTAGTCTGATGGG - Intergenic
996302521 5:122006252-122006274 AAATTTGCTGCTAGTCTTATTGG + Intronic
997087593 5:130819374-130819396 AAATCTGCTGTTAGTCTGATGGG - Intergenic
998288948 5:140893721-140893743 AAATCTGCTGTTAGTCTGATGGG + Intronic
998982476 5:147720212-147720234 AAATCTGCTGTTAGTCTGATGGG + Intronic
1000539168 5:162518761-162518783 AAGTCTGCTGCTAGACATATTGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000686786 5:164259616-164259638 AATTCTGCTGATCGTCATATTGG - Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1001502777 5:172251552-172251574 AAATCTGCTGCTAGCCATATTGG - Intronic
1002996301 6:2288308-2288330 TAATCTGCTGTTAGTCTGATGGG - Intergenic
1003813610 6:9812390-9812412 AAATCTGCTGTTAGTCTGATGGG - Intronic
1004028179 6:11838976-11838998 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1004798257 6:19114245-19114267 AAATCTGCTGACAGCCATGTTGG + Intergenic
1004843882 6:19616694-19616716 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1005102238 6:22184572-22184594 AAATCTGCTGTTAGTCTAATAGG + Intergenic
1006050593 6:31340033-31340055 AAATCTGCTGTTAGTCTGATGGG + Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG + Intergenic
1008193422 6:48488108-48488130 AAATCTGCTAAAAGTTATATTGG - Intergenic
1008751895 6:54745029-54745051 AAATCTGCTGATAGTCTAATGGG + Intergenic
1009232315 6:61078282-61078304 AAATTTGCTGATAGCCACATTGG + Intergenic
1009467642 6:63991870-63991892 AAATCTACTGATAGTCTCATGGG - Intronic
1009477860 6:64116292-64116314 AAATCCACTGATAGCCATATAGG - Intronic
1010530369 6:76960616-76960638 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010875158 6:81094741-81094763 TTATATGCTGATAGTTATATTGG + Intergenic
1010941956 6:81929755-81929777 TAATCTGCTGATGGACATTTGGG + Intergenic
1011026893 6:82879263-82879285 CAAACTGATGATAGTCAAAGGGG - Intergenic
1011124905 6:83996564-83996586 CCATCTGTTGATAGACATTTTGG - Intergenic
1011234397 6:85200185-85200207 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1011392124 6:86865755-86865777 AATTCTGCTGATAGTCATATTGG - Intergenic
1011500507 6:87983224-87983246 AAATCTGCTGACAGCCATATGGG - Intergenic
1011804659 6:91058733-91058755 AAATTTGCTGCAAGTCATATTGG + Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012878610 6:104758327-104758349 AGATCTGCTGATAGTCTGATGGG - Intronic
1013810677 6:114041290-114041312 CAATGTGCTTATAGTCATTGGGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1013983737 6:116165197-116165219 AAATCTGCTGTTAGTCTGATAGG + Intronic
1014013462 6:116502653-116502675 AAATCTGCTGTTAGTCTGATGGG - Intronic
1014176854 6:118340904-118340926 AGATCTGCTGATAGTCTGATGGG + Intergenic
1014190357 6:118488839-118488861 AAATCTGCTCATAGTCTTATTGG - Intronic
1014352476 6:120362145-120362167 AGATCTGCTGTTAGTCTTATGGG + Intergenic
1014737491 6:125111419-125111441 AAATCTGCTGATAGTCTCATGGG + Intergenic
1015077015 6:129171538-129171560 CGATCTGCTGTTAGTCTGATGGG + Intronic
1015081082 6:129226695-129226717 CGATCTGCTGTTAGTCTGATGGG + Intronic
1015139735 6:129916347-129916369 CACTCTGCTGATAGACACTTGGG + Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015302150 6:131666215-131666237 AAACCTGCTGATAGTTTTATAGG + Intronic
1015392314 6:132696594-132696616 AAATCTGCCGATAATCTTATTGG - Intronic
1016005845 6:139088785-139088807 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1016138791 6:140582501-140582523 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1016289812 6:142516982-142517004 AAATCTGCTGTTAATCCTATAGG + Intergenic
1016496902 6:144674006-144674028 AAATCTGCTGTTAATCTTATAGG + Intronic
1016839573 6:148512895-148512917 CGGTTTGCTGATAGTCATACAGG + Intronic
1018755432 6:166844549-166844571 AAATCTGCTGTTAATCTTATAGG - Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020672795 7:11138877-11138899 CCATCTGCTGGTATTCAGATAGG - Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021081684 7:16372327-16372349 AAATCTGCTGTTAGTCTAATAGG - Intronic
1021795729 7:24252167-24252189 AAATCTGCTGATGATCATATTGG - Intergenic
1021980576 7:26050850-26050872 TCATCTGCTGATAGACATTTAGG + Intergenic
1022152307 7:27620389-27620411 AAATCTTCTGTTAGTCTTATGGG - Intronic
1022985824 7:35652498-35652520 AAATCTGCTGATAGTCTGCTGGG - Intronic
1023102357 7:36731785-36731807 AAATCTGCTGAAAGCCATATTGG + Intergenic
1023474815 7:40565265-40565287 CTTTCTGTTGATAGTTATATTGG + Intronic
1024015410 7:45309931-45309953 AAATCTGCTGTTAGTCTCATGGG + Intergenic
1024017891 7:45334629-45334651 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024897209 7:54273922-54273944 AAATCTGCAGATAGTCATATTGG + Intergenic
1025529447 7:61860024-61860046 CATTCTGCAGATGGCCATATGGG - Intergenic
1025577682 7:62668622-62668644 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1025599340 7:62975841-62975863 CATTCTGCTGATGGACATTTGGG + Intergenic
1026490410 7:70858241-70858263 CAATATGCTGAAAGCAATATGGG - Intergenic
1026634798 7:72072296-72072318 AAATCTGCTCATACTCATGTTGG - Intronic
1027524280 7:79246937-79246959 AATTCTGCTGCTAGACATATTGG - Intronic
1028206993 7:88029831-88029853 AAATCTGCTGCCAGGCATATTGG + Intronic
1028226029 7:88253812-88253834 AAATCTGCTGATAGTCTAATGGG + Intergenic
1028261836 7:88675558-88675580 AAATCTGCTGTTAATCAGATAGG - Intergenic
1028573500 7:92318768-92318790 CTAGCTACTGATAGCCATATTGG - Intronic
1029165159 7:98583515-98583537 TCATCAGCTGATAGTCATATGGG - Intergenic
1030517497 7:110556715-110556737 AAGTCTACTGATAGTCTTATGGG + Intergenic
1031170583 7:118287657-118287679 AAATCTGCTGGTAGCCATAATGG - Intergenic
1031238922 7:119213633-119213655 AAATCTGCTGATAGCCTTATTGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032309368 7:130769012-130769034 AAATCTGCTGATGGTCTTATGGG - Intergenic
1032644957 7:133813287-133813309 CAATCTGCTCATAAACAGATGGG - Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034581563 7:152048253-152048275 AAATCTGCTGCCAGACATATTGG + Intronic
1035551372 8:529727-529749 AAATCTGCTGATAATCTTATGGG + Intronic
1036221548 8:6925173-6925195 CAAACTGGAGACAGTCATATGGG - Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037083694 8:14819209-14819231 CAATCTTCTGATAGTCTAATGGG - Intronic
1037596726 8:20360550-20360572 CAATCTGCTGATAATGGTCTTGG + Intergenic
1038871731 8:31502566-31502588 AAGTCTGCTGCTAGGCATATTGG + Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039641640 8:39228960-39228982 AAATCTGCTGATAATCTGATAGG - Intronic
1039646370 8:39288764-39288786 AAATCTGCTGATAGTTGTATTGG + Intergenic
1040090908 8:43397703-43397725 AAATCTGCTGTTAGTCCAATGGG + Intergenic
1040628465 8:49179721-49179743 TAATCTGCTGATAGACACTTAGG - Intergenic
1041447793 8:57971807-57971829 CCAACTGCTGATAGACATCTGGG + Intergenic
1042361599 8:67889967-67889989 TTATCTGCTTATAGTCATTTGGG - Intergenic
1042534534 8:69845048-69845070 CAATCTGCTGTTAGTCTGATGGG - Intergenic
1042756333 8:72216650-72216672 AAATTTGCTGATAATCATATTGG - Intergenic
1043227225 8:77747724-77747746 AAGTCTGCTGCTAGACATATTGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044576790 8:93778717-93778739 AAATCTGCTGTTAGTCTGATGGG + Intronic
1045067449 8:98461844-98461866 AAATCTGCTGTTAGTCTGATAGG + Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046142270 8:110109171-110109193 TCATCTGCTGATGGACATATAGG + Intergenic
1046394762 8:113626914-113626936 CAATCTGCTGTTAATCTGATAGG - Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046702896 8:117420432-117420454 CAGTCTGTTGTTAGTCTTATGGG - Intergenic
1048411493 8:134178743-134178765 AAATCTGCTCATAATCTTATTGG + Intergenic
1048673567 8:136751008-136751030 AAATCTGCTGATAGTAGAATTGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050133754 9:2440208-2440230 AAATCTGCTGTTAATCTTATAGG + Intergenic
1050406668 9:5315730-5315752 AAATTTGCTGATAGTCTAATGGG - Intergenic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1050956921 9:11675384-11675406 AAATCTGCTGATAGTCTTATGGG + Intergenic
1050973722 9:11910769-11910791 AGATCTGCTGTTAGTCTTATGGG + Intergenic
1051232680 9:14968718-14968740 AGATCTGCTGTTAGTCTTATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052155252 9:25179465-25179487 AAATCTGCTGATAGTTTTAGAGG - Intergenic
1052525263 9:29609369-29609391 AAGTCTGCTGCTAGTCATATTGG - Intergenic
1055563082 9:77541395-77541417 AAGTCTGCTGTTAGTCAGATAGG + Intronic
1056906298 9:90651439-90651461 AACTCTGCTGATAATCTTATTGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186645465 X:11502400-11502422 TGATCTGATGATAGTCACATGGG + Intronic
1186751513 X:12626456-12626478 AAATCTGCTGATAGTTGTATTGG - Intronic
1187772242 X:22712990-22713012 TAATCTGTTGATAGAAATATGGG - Intergenic
1188746087 X:33846114-33846136 AAATCTGCTGATAGTCTAAGGGG + Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1188915268 X:35903213-35903235 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189084073 X:38001690-38001712 CCATCTGTTGATGGACATATAGG + Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191161281 X:57331770-57331792 CAATATGCTGTAAATCATATGGG - Exonic
1191180445 X:57557517-57557539 AAATCTGCTGTTAATCTTATAGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1191800572 X:65074335-65074357 AAATCTACTGATAGTTTTATGGG + Intergenic
1192002663 X:67171511-67171533 AAGTCTGCTGACAGTCGTATTGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192715216 X:73633388-73633410 AAATCTGCTGATTTTCTTATTGG + Intronic
1192878292 X:75255131-75255153 AAATCTGCTGTTAGTCTGATAGG - Intergenic
1192973611 X:76259720-76259742 AGATCTGCTGATAGTCTGATGGG + Intergenic
1192997327 X:76526195-76526217 AGATCTGCTGTTAGTCTTATGGG + Intergenic
1193078112 X:77376614-77376636 AAATCTGCTGTTAATCTTATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193366468 X:80639495-80639517 AAATCTGCTGTTAATCTTATAGG - Intergenic
1193548902 X:82865216-82865238 AAGTCTGCTGATAGCCTTATGGG - Intergenic
1194006873 X:88505655-88505677 AAGTCTGCTGATAGACATATTGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194358222 X:92915466-92915488 ATGTCTGCTGACAGTCATATTGG + Intergenic
1194538847 X:95145068-95145090 AAATCTGCTGAAAGTAAGATTGG + Intergenic
1195414412 X:104604084-104604106 CAATCTGCTGTTAGTCTGATGGG - Intronic
1195425106 X:104719948-104719970 CTTTCTGCAGATAGTCATACTGG + Intronic
1196561401 X:117153446-117153468 AGATCTGCTGTTAGTCTTATGGG - Intergenic
1197373699 X:125656496-125656518 TTATCTGATGATAGTAATATCGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197493659 X:127151427-127151449 AAATCTGCTGTTAGTCTGATAGG + Intergenic
1197960599 X:132001447-132001469 CAACCTGCTTTTAGTCACATAGG + Intergenic
1197960744 X:132003478-132003500 CAACCTGCTTTTAGTCACATAGG - Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198836683 X:140813389-140813411 AAATCTGCTGTTAGTCTGATAGG + Intergenic
1198927268 X:141813197-141813219 AAATCTGCTGCCAGACATATTGG + Intergenic
1199317048 X:146393260-146393282 AAATCTGCTGCTAGACATATTGG + Intergenic
1200345595 X:155443805-155443827 AAATCTGCTGTTAGTCTAATGGG - Intergenic
1200666398 Y:6031123-6031145 ATGTCTGCTGACAGTCATATTGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201326093 Y:12760585-12760607 CAATCTGATGCTATTCATGTAGG - Exonic
1201547292 Y:15179568-15179590 TAATCTTCTGAGAGTCATAAGGG - Intergenic
1201908879 Y:19113280-19113302 AAATCTGCTGTTAGTCTGATTGG + Intergenic
1201945751 Y:19508384-19508406 CAATCAGCTGTTAGTCTGATGGG + Intergenic
1202014343 Y:20384918-20384940 CAATCAGCTGTTAGTCTGATTGG + Intergenic
1202040040 Y:20672873-20672895 AGGTCTGTTGATAGTCATATTGG - Intergenic
1202043800 Y:20715650-20715672 AAATCTGCTGTTAATCTTATAGG - Intergenic
1202333236 Y:23777372-23777394 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1202537533 Y:25892691-25892713 AAATCTGCTGTTAGTCTGATGGG - Intergenic