ID: 923440107

View in Genome Browser
Species Human (GRCh38)
Location 1:234009782-234009804
Sequence CAATCTGCTGATAGTCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 1, 2: 12, 3: 104, 4: 475}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923440107_923440108 -3 Left 923440107 1:234009782-234009804 CCAATATGACTATCAGCAGATTG 0: 1
1: 1
2: 12
3: 104
4: 475
Right 923440108 1:234009802-234009824 TTGCTCAGCAGAACCCCTTCTGG 0: 1
1: 0
2: 2
3: 56
4: 358
923440107_923440111 11 Left 923440107 1:234009782-234009804 CCAATATGACTATCAGCAGATTG 0: 1
1: 1
2: 12
3: 104
4: 475
Right 923440111 1:234009816-234009838 CCCTTCTGGCCAAGAGAGAGTGG 0: 1
1: 0
2: 2
3: 50
4: 599
923440107_923440113 12 Left 923440107 1:234009782-234009804 CCAATATGACTATCAGCAGATTG 0: 1
1: 1
2: 12
3: 104
4: 475
Right 923440113 1:234009817-234009839 CCTTCTGGCCAAGAGAGAGTGGG 0: 1
1: 0
2: 2
3: 32
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923440107 Original CRISPR CAATCTGCTGATAGTCATAT TGG (reversed) Intronic