ID: 923443752

View in Genome Browser
Species Human (GRCh38)
Location 1:234048523-234048545
Sequence GTGGTAGCCCTGATAATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923443752_923443756 -4 Left 923443752 1:234048523-234048545 CCAGAGATTATCAGGGCTACCAC 0: 1
1: 0
2: 0
3: 10
4: 77
Right 923443756 1:234048542-234048564 CCACTTCCACCATGGGATCATGG 0: 1
1: 0
2: 0
3: 17
4: 182
923443752_923443760 27 Left 923443752 1:234048523-234048545 CCAGAGATTATCAGGGCTACCAC 0: 1
1: 0
2: 0
3: 10
4: 77
Right 923443760 1:234048573-234048595 TGCCTCTACCTCATTTTCAAAGG 0: 1
1: 0
2: 4
3: 30
4: 269
923443752_923443757 -3 Left 923443752 1:234048523-234048545 CCAGAGATTATCAGGGCTACCAC 0: 1
1: 0
2: 0
3: 10
4: 77
Right 923443757 1:234048543-234048565 CACTTCCACCATGGGATCATGGG 0: 1
1: 0
2: 1
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923443752 Original CRISPR GTGGTAGCCCTGATAATCTC TGG (reversed) Intronic
902898027 1:19492877-19492899 GTGGTAGCCTTACTGATCTCAGG - Intergenic
903331953 1:22601054-22601076 GCGGTGGCCCTGAGACTCTCAGG - Exonic
904064530 1:27738874-27738896 GTGGTAGCCATGGGAAGCTCTGG + Intronic
908468821 1:64421968-64421990 GAGGCAGCCCTGATTATCTCTGG + Intergenic
920251965 1:204627909-204627931 GTGGTAGCTCAGAGAATATCCGG + Intronic
921586667 1:216954679-216954701 GTGATAGCCTTGATATTCTGAGG - Intronic
922004550 1:221516488-221516510 GAGGGAGCCATGATATTCTCAGG + Intergenic
923198816 1:231692446-231692468 GGGGTGGCATTGATAATCTCTGG - Intronic
923443752 1:234048523-234048545 GTGGTAGCCCTGATAATCTCTGG - Intronic
1066421582 10:35268945-35268967 CTGGTAGCCCTGGAGATCTCTGG + Intronic
1069949497 10:72009371-72009393 GAGGTAGCCATGAGAATCTAAGG - Exonic
1071312230 10:84353634-84353656 GTGGTAGCCATGCTAATTGCAGG - Intronic
1079285984 11:19132978-19133000 ATGGTAGCCCTTATAAATTCTGG - Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083893454 11:65608295-65608317 GTGGAGGCCTTGATAACCTCAGG + Exonic
1095630278 12:44368113-44368135 GAGGAAGCCCTGAGAAGCTCTGG - Intronic
1098167145 12:67710325-67710347 GTGGAAGCCCTGAGAAACGCAGG + Intergenic
1099877884 12:88431684-88431706 GAGGTGGCCCTGGTTATCTCTGG + Intergenic
1100531929 12:95468987-95469009 GTGGCAGCCCCTATACTCTCAGG + Intergenic
1103440962 12:120962708-120962730 GTGGCATCCTTGATAATGTCAGG + Intergenic
1107916998 13:45162671-45162693 GTGGTAGCTTTAATAATCTGAGG + Intronic
1108077238 13:46694003-46694025 ATGGTTCCCATGATAATCTCAGG - Intronic
1115954835 14:38766082-38766104 GTGTTAGCCAGGATGATCTCAGG + Intergenic
1117581237 14:57153768-57153790 GTGGCAGCCTTGATGATGTCTGG - Intergenic
1121254603 14:92522009-92522031 GTGGGAGCCCTAAGAATCTGGGG + Intronic
1126302453 15:47213373-47213395 GTGGTAGCGCTGGTCATCTGTGG - Intronic
1128678938 15:69632630-69632652 ATGGTAACCCTAAAAATCTCAGG + Intergenic
1128825864 15:70716290-70716312 ATGGCAGCACTGATAATGTCTGG - Intronic
1129543052 15:76366926-76366948 GTGGCAGCCCTGAGACTCTGAGG + Intronic
1130859492 15:87874018-87874040 GGGGTACACCTGCTAATCTCTGG - Intronic
1134054343 16:11160069-11160091 GTGGAATCCCCTATAATCTCAGG + Intronic
1137576974 16:49606512-49606534 GTGGTAGCCCTGATGGACTGGGG + Intronic
1147728009 17:42578691-42578713 TTGTTAGCCCAGACAATCTCAGG + Intergenic
1156386749 18:36611948-36611970 CTGGTAGTCCTGATAACGTCTGG - Exonic
1156568491 18:38223425-38223447 GTGGCAATCCTGATAATCTCTGG - Intergenic
1156570548 18:38247288-38247310 CTGGTGGCCCTGCTACTCTCAGG + Intergenic
1163222165 19:15929468-15929490 GTGATAGGCCGGATAATGTCAGG + Exonic
1163962963 19:20714599-20714621 CTGGTTGCCCTTATATTCTCTGG - Intronic
925920929 2:8637392-8637414 GGGCTAGCCCTGATATTCCCAGG - Intergenic
927138795 2:20115800-20115822 GTGGTCCCCATGAGAATCTCGGG + Intergenic
930644925 2:53895681-53895703 GTGATAGGCCTGATAATCATTGG - Exonic
932464579 2:71908829-71908851 GTGGTAGCCATGAAAACCTTGGG - Intergenic
936156834 2:110052391-110052413 GTGTTAGCACTGATAAAATCTGG + Intergenic
936187860 2:110319053-110319075 GTGTTAGCACTGATAAAATCTGG - Intergenic
937730372 2:125222828-125222850 GTGGTAGCCCTTCCAATCACAGG - Intergenic
937953393 2:127405514-127405536 GTGGGGGCCCAGATAATGTCAGG + Intergenic
938974774 2:136465726-136465748 GAGGAAGCCCTGATAATACCAGG - Intergenic
1170823910 20:19777219-19777241 GTGGAACCCCTGGAAATCTCAGG + Intergenic
1171302092 20:24072026-24072048 GTGGTAGCCTTGAAAACATCAGG - Intergenic
1173118096 20:40265212-40265234 TTGGTAGCCCTGATCAGTTCTGG + Intergenic
1177774660 21:25554753-25554775 GTGGCAGCCCTGATGACCTCTGG - Intergenic
1183147302 22:36005219-36005241 GTGGTAGCCTTGAGAAACTAGGG - Intronic
1184302896 22:43572976-43572998 GTGGTAGCACTGGCATTCTCTGG - Intronic
950877516 3:16289626-16289648 GTGGCAGCCCTGATTCTCACAGG + Intronic
953240349 3:41143151-41143173 GAGGTGTCCCTGATAATCTGTGG - Intergenic
954812582 3:53257114-53257136 GTGGTAGCCATGACAATGCCAGG + Intergenic
955315302 3:57933610-57933632 CTGGTTGCCCAGATATTCTCTGG - Intergenic
961589483 3:127965918-127965940 CTGGAACCCCAGATAATCTCAGG + Intronic
962640999 3:137386256-137386278 CTGGCAGCCCTGATGATCTCTGG + Intergenic
963510461 3:146241418-146241440 GTGATAGCCCTTCTTATCTCTGG - Intronic
963867162 3:150374774-150374796 ATGTTAGCCCTGATTATCTCTGG + Intergenic
964814112 3:160698289-160698311 ATGGGAACACTGATAATCTCAGG + Intergenic
973659474 4:53088247-53088269 AAGGCAGCCCTGATGATCTCTGG - Intronic
976809032 4:89080513-89080535 GTGGTAGTCCAGAAAATCCCTGG - Intronic
977377281 4:96221666-96221688 GAGGTAACAGTGATAATCTCTGG + Intergenic
978899968 4:113937176-113937198 GTGTGAGCACTGAGAATCTCTGG - Intronic
981137102 4:141222896-141222918 GGGTTAGTCCTGATAATTTCTGG + Intronic
981741530 4:148007295-148007317 GGGGTTGCCCTGATCATTTCAGG - Intronic
982013938 4:151133598-151133620 GTGCTAACCCTGAGAATCTCAGG + Intronic
985790325 5:1923332-1923354 AATGTAGCCCTGATCATCTCTGG - Intergenic
990596739 5:57319736-57319758 GTGGGAGGCCAGATAATCCCTGG + Intergenic
993358795 5:86947329-86947351 GAAGTAGCCCTGCTGATCTCTGG + Intergenic
995602237 5:113810253-113810275 GTGGTAGGCTGGATAATGTCCGG + Intergenic
1007334422 6:41142300-41142322 GTGGTAACACTGATTATCTCTGG - Intergenic
1010554169 6:77258397-77258419 GTGGTAGCTCTGATAACCACTGG + Intergenic
1023727262 7:43156715-43156737 GTGGTAGCCCTGTTCACCTTAGG + Intronic
1024578732 7:50784821-50784843 GTGGAAGCCCAGAAAGTCTCAGG + Intronic
1026930132 7:74219372-74219394 GAGGTAGCCCTGAGATTCTGGGG - Intronic
1039456352 8:37710011-37710033 GGGGGAGCCCTGCTAACCTCTGG + Intergenic
1040035042 8:42861750-42861772 TGGGTTGCCCTGAGAATCTCCGG + Exonic
1059704976 9:116814219-116814241 GTTCTAGCCCTGATGATCCCAGG - Intronic
1060890523 9:127185091-127185113 GTGGTATCCCTGGTACTGTCAGG - Intronic
1187988865 X:24847641-24847663 GTTGTAGGCTTTATAATCTCAGG + Intronic
1189472254 X:41323116-41323138 GTGGTAGCCCTGGTAGTCCAGGG + Intergenic
1193393375 X:80955987-80956009 ATGGTAGCCCTTATAATCGGAGG - Intergenic
1193810593 X:86046564-86046586 GTGGTAGGCCAGAGAAGCTCTGG - Intronic
1194409877 X:93544194-93544216 GTGGTAGCCCCTCTAATCACAGG - Intergenic
1199482545 X:148312875-148312897 GGGGTAGCCCTGATGATATCTGG - Intergenic