ID: 923445477

View in Genome Browser
Species Human (GRCh38)
Location 1:234066658-234066680
Sequence CTCAAATAGAAGTTGGACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 86}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923445464_923445477 21 Left 923445464 1:234066614-234066636 CCTTCTCCTTCCCAAAGATAAAA 0: 1
1: 0
2: 3
3: 76
4: 579
Right 923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG 0: 1
1: 0
2: 1
3: 8
4: 86
923445468_923445477 11 Left 923445468 1:234066624-234066646 CCCAAAGATAAAAAGGGTTGCCC 0: 1
1: 0
2: 1
3: 10
4: 130
Right 923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG 0: 1
1: 0
2: 1
3: 8
4: 86
923445471_923445477 -10 Left 923445471 1:234066645-234066667 CCCTGCCCTACTTCTCAAATAGA 0: 1
1: 0
2: 1
3: 9
4: 177
Right 923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG 0: 1
1: 0
2: 1
3: 8
4: 86
923445467_923445477 15 Left 923445467 1:234066620-234066642 CCTTCCCAAAGATAAAAAGGGTT 0: 1
1: 1
2: 1
3: 26
4: 394
Right 923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG 0: 1
1: 0
2: 1
3: 8
4: 86
923445469_923445477 10 Left 923445469 1:234066625-234066647 CCAAAGATAAAAAGGGTTGCCCC 0: 1
1: 0
2: 1
3: 5
4: 91
Right 923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG 0: 1
1: 0
2: 1
3: 8
4: 86
923445463_923445477 27 Left 923445463 1:234066608-234066630 CCACTACCTTCTCCTTCCCAAAG 0: 1
1: 0
2: 3
3: 68
4: 799
Right 923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG 0: 1
1: 0
2: 1
3: 8
4: 86
923445462_923445477 28 Left 923445462 1:234066607-234066629 CCCACTACCTTCTCCTTCCCAAA 0: 1
1: 0
2: 3
3: 48
4: 504
Right 923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG 0: 1
1: 0
2: 1
3: 8
4: 86
923445470_923445477 -9 Left 923445470 1:234066644-234066666 CCCCTGCCCTACTTCTCAAATAG 0: 1
1: 0
2: 1
3: 13
4: 179
Right 923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG 0: 1
1: 0
2: 1
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923445477 Original CRISPR CTCAAATAGAAGTTGGACGA GGG Intronic
909149496 1:71983708-71983730 CACAAATAGAGATTGGACAAAGG + Intronic
909300819 1:74011021-74011043 CTCAAATGGAAGTAGGAAGGTGG + Intergenic
910162578 1:84289676-84289698 CTAAAATAGGAGTAGGACGGGGG - Intergenic
921713329 1:218394531-218394553 CTCAAATAGCAGTTAGATGAAGG + Intronic
923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG + Intronic
923885377 1:238149453-238149475 CATAAATAGAAATTGGACAAAGG - Intergenic
1065031806 10:21594060-21594082 CTCAAACTGAAATTTGACGAAGG - Intronic
1073973383 10:109071371-109071393 CACACACAGAAGTTGGAGGAGGG - Intergenic
1075847637 10:125557903-125557925 TTCAAATATAAGTTGGTAGATGG + Intergenic
1081083369 11:38769833-38769855 CTGAAATAGAATTAAGACGATGG + Intergenic
1086943344 11:92820624-92820646 CTCAAATGGAGGTTGGAGGGTGG - Intronic
1093774871 12:23061919-23061941 ACCAAATAGAAGTGGGAAGAGGG + Intergenic
1095326265 12:40897007-40897029 CTGACTTAGAAGTTGGAAGATGG + Intronic
1096036903 12:48480282-48480304 CTCAATTAAAAATTGGACAAAGG - Intergenic
1099349338 12:81545586-81545608 CAAAAATAGAAGTTGCACCATGG + Intronic
1099896937 12:88660129-88660151 CTCAAATAGAAATTTAACTATGG - Intergenic
1103139597 12:118536922-118536944 CTGAAATAGAAGTTCCATGAGGG + Intergenic
1106468187 13:30031526-30031548 CTGAAATAGAAGTTAAAAGATGG + Intergenic
1108935389 13:55875356-55875378 CTCAAACTGAAGATGGAAGATGG - Intergenic
1109770178 13:66961027-66961049 CACAAATAGAAGATAGACAAAGG - Intronic
1114951973 14:27766019-27766041 CTGAAATAAAAGTTAAACGAAGG + Intergenic
1123577924 15:21691198-21691220 CACAAATAGAATTTGGAGTATGG + Intergenic
1123614549 15:22133680-22133702 CACAAATAGAATTTGGAGTATGG + Intergenic
1124132984 15:27006499-27006521 CTAAAATAAAAGTTGGAAGAGGG - Intronic
1126682561 15:51217004-51217026 GTCAATTAGAATTTGGAAGATGG - Intronic
1127653948 15:61037793-61037815 CTATAATAGAAGATGGAAGAAGG + Intronic
1130363486 15:83211417-83211439 CTCATATATAACTTGGACAAAGG - Intergenic
1202986794 15_KI270727v1_random:425443-425465 CACAAATAGAATTTGGAGTATGG + Intergenic
1133240286 16:4410027-4410049 TTCAAGTAGAAGCTGGACCAGGG - Intronic
1133376674 16:5293022-5293044 TTCAAATAGAATTTGGAGGCTGG + Intergenic
1133505747 16:6410596-6410618 CTCAAATAGAAGGTGCGCGGTGG - Intronic
1135882815 16:26275695-26275717 CTCTAATAGAAGATGTACAAGGG + Intergenic
1135957906 16:26971711-26971733 CTCAAATGGAAGTTCTATGAAGG + Intergenic
1146147318 17:30431288-30431310 CTCAATTAAAAATTGGACAAAGG - Intronic
1147951708 17:44111259-44111281 CTGAAATAGCAGTTGGGGGAGGG + Intronic
1150689855 17:67355829-67355851 CTCAAAAATAAGTTGGAAGCCGG + Intronic
1164699043 19:30269348-30269370 CTCAACTGGAAGTTGCACCAGGG + Intronic
925882914 2:8368094-8368116 CTGAAAGAGAAGATGGATGAGGG - Intergenic
926409469 2:12587864-12587886 CTCCATTAGAAGTTGGAACAAGG + Intergenic
928067990 2:28186279-28186301 CACAGATAGAAGTGGGATGATGG - Intronic
929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG + Intergenic
933920416 2:87040045-87040067 CCCAGCTAGAAGTTGGAAGATGG + Intergenic
933931208 2:87153741-87153763 CCCAGCTAGAAGTTGGAAGATGG - Intergenic
934002581 2:87729853-87729875 CCCAGCTAGAAGTTGGAAGATGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
935584437 2:104788051-104788073 TTCAGATAAAAGTTGGACCAAGG - Intergenic
936361915 2:111811691-111811713 CCCAGCTAGAAGTTGGAAGATGG + Intronic
937004139 2:118496116-118496138 CTCCAATAGAATTTTGAGGAGGG - Intergenic
939304513 2:140393580-140393602 CTGAAATAGAAGATGGAAAATGG - Intronic
942028800 2:171937727-171937749 CTGAAATAGAAGTAGCATGATGG + Intronic
942855534 2:180542171-180542193 CTGAAATAGAAGTTAGTTGATGG + Intergenic
943210358 2:184956526-184956548 ATAAAATAGAAGCTGGAGGAAGG + Intergenic
1174534684 20:51241887-51241909 CTCAAATGGGAGCTGGACTAAGG - Intergenic
1176992203 21:15510480-15510502 GTCAAATTGAAGTTGGACACAGG - Intergenic
1178662376 21:34518668-34518690 CTCAAATAGGAGCTGCATGAGGG - Intronic
1179306749 21:40160916-40160938 CACAAATTGAACTTGGACTAAGG - Intronic
1182044787 22:27265802-27265824 CACAGATAGAAGTTGGAAGTCGG + Intergenic
953175717 3:40550311-40550333 CTCAAATACCAGTTGGAGGAGGG - Intronic
953570065 3:44064257-44064279 CTCAACTAGAAGTTGGACTATGG - Intergenic
954880373 3:53831700-53831722 CTCAAATAGAAAATGGCCAAAGG + Intronic
956486522 3:69728701-69728723 CTCAAATAGAAATCAGAAGAGGG - Intergenic
957065613 3:75519495-75519517 TTCAAATAGAATTTGGAGGCTGG - Intergenic
961287716 3:125819926-125819948 TTCAAATAGAATTTGGAGGCTGG + Intergenic
962938334 3:140102276-140102298 CCCAAAGAGAAGTTGTACCAAGG + Intronic
964431906 3:156616151-156616173 CATAAATAGAATTTGGAGGAGGG - Intergenic
965534490 3:169811159-169811181 CCCAAATAGAAGTTGGAGCTGGG + Intronic
969803436 4:9587785-9587807 TTCAAATAGAATTTGGATGCTGG + Intergenic
973206725 4:47569299-47569321 CTCAAATAGGTGATGGAGGAAGG - Intronic
975567422 4:75773182-75773204 CTCAAATAAAAGTTGAAAAAAGG - Intronic
980522375 4:133950602-133950624 CTCAAACTGAAGATGGAAGATGG - Intergenic
982024137 4:151235044-151235066 CTAAAATAAAAGTTGGAGGCTGG - Intronic
982396848 4:154923203-154923225 CTCCAATACAAATTTGACGATGG - Intergenic
986537978 5:8812593-8812615 CTAAAATAGAAGTTGGATAAAGG + Intergenic
989315859 5:40077938-40077960 CTCAAAAAGTGGTTGGACCAGGG - Intergenic
997866409 5:137467403-137467425 CTCAAATAGTTGTTGAAAGAAGG - Intronic
1000005733 5:157182808-157182830 CACAAATAGCAGTTGGGCTAAGG - Intronic
1000473345 5:161674048-161674070 TTCAAATATAAGTTGGCTGAAGG + Intronic
1002382075 5:178838383-178838405 ATCAAGTAGAAGCTGGAGGATGG + Intergenic
1002648652 5:180674882-180674904 ATCAAGTAGAAGCTGGAGGATGG - Intergenic
1011431662 6:87293867-87293889 CTCACACAGAAGCTGGAAGACGG + Intronic
1013088350 6:106875778-106875800 CTCAAAGAGAATCTGTACGAGGG - Intergenic
1025145630 7:56499700-56499722 CTCAAATAGAAATTGAACAACGG + Intergenic
1030439970 7:109576918-109576940 CTCAAATAGAAGTGATAAGAAGG + Intergenic
1031907251 7:127474428-127474450 CTCAAAGAGAAGTAGGGGGAAGG - Intergenic
1032310684 7:130783947-130783969 CTGAAATAGAAGATAGAAGATGG - Intergenic
1035334701 7:158120451-158120473 CTGAAATAGAGATTGGACGAAGG - Intronic
1042045014 8:64640924-64640946 CACAAATAGAAGTTGCCCTATGG - Intronic
1049764139 8:144345499-144345521 CTGAAATAGAAGTTGGCAGCTGG + Intergenic
1052359730 9:27541053-27541075 CTCAACTAAAAGTTAGAGGAGGG + Intergenic
1187850489 X:23586859-23586881 CTCAAAAAGAGGTTGGTCAAAGG + Intergenic
1188736354 X:33721297-33721319 CTCAAATAGTAGCTGAACGGTGG + Intergenic
1191838944 X:65495740-65495762 TTTAAATAGAAATTGGAAGAGGG - Intronic
1198304576 X:135368073-135368095 TTCAAATAGAAATTGGCCAAAGG + Intergenic
1202018160 Y:20434334-20434356 CTCAAAAAGAAGATAGATGATGG - Intergenic