ID: 923447865

View in Genome Browser
Species Human (GRCh38)
Location 1:234089307-234089329
Sequence GAGGTAGAACTCACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923447860_923447865 12 Left 923447860 1:234089272-234089294 CCTGAAAGTCAGTCAGCCTGGGC 0: 1
1: 0
2: 1
3: 17
4: 157
Right 923447865 1:234089307-234089329 GAGGTAGAACTCACTGTGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 180
923447862_923447865 -4 Left 923447862 1:234089288-234089310 CCTGGGCTGTGAGGATTGTGAGG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 923447865 1:234089307-234089329 GAGGTAGAACTCACTGTGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 180
923447857_923447865 29 Left 923447857 1:234089255-234089277 CCTCTCAGTTTGCATCACCTGAA 0: 1
1: 0
2: 1
3: 7
4: 145
Right 923447865 1:234089307-234089329 GAGGTAGAACTCACTGTGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923447865 Original CRISPR GAGGTAGAACTCACTGTGGA AGG Intronic
903407083 1:23106826-23106848 GTGGGAGAACAGACTGTGGAGGG - Intronic
903664807 1:24999768-24999790 GAGGGAGAGGTCTCTGTGGAAGG - Intergenic
904079324 1:27862269-27862291 GAGGTGTCATTCACTGTGGAGGG + Intergenic
905345954 1:37311405-37311427 GGGGTTGAACTCACTGGGGTGGG - Intergenic
906348705 1:45038557-45038579 GAGGTAGAACAGAGTCTGGAAGG + Intronic
912342279 1:108928457-108928479 GAGGTGGCACTCACTTAGGAGGG + Intronic
913051315 1:115119273-115119295 GAGGTTTTACTCATTGTGGAAGG + Intergenic
915025317 1:152824104-152824126 GAGGGAAAAGTTACTGTGGATGG - Intergenic
917554475 1:176069622-176069644 GAGGGAGAACCCTCTGGGGATGG - Intronic
919738459 1:200968282-200968304 GAGGCAGAAGTCACCGTGGGTGG - Intergenic
923447865 1:234089307-234089329 GAGGTAGAACTCACTGTGGAAGG + Intronic
923532278 1:234820884-234820906 GATGTGGGACTCACTGGGGAAGG + Intergenic
924041876 1:239991944-239991966 AAGGGAGAACTCCGTGTGGACGG - Intergenic
1067879262 10:50029587-50029609 GATGTAGAATGCATTGTGGAAGG + Intergenic
1067892635 10:50149844-50149866 GATGTAGAATGCATTGTGGAAGG - Intergenic
1069119803 10:64555714-64555736 GAGGTAGAACTCAGTTTAGAGGG - Intergenic
1069598971 10:69691060-69691082 GAGCTTTTACTCACTGTGGAAGG - Exonic
1071967689 10:90868869-90868891 GTGGTAGAACTACATGTGGATGG - Intergenic
1075144406 10:119871699-119871721 CAGCTAGAAATCACTGTAGATGG - Intronic
1076667561 10:132101879-132101901 GATGAAGAACCCACTGGGGAAGG - Intergenic
1076780562 10:132721893-132721915 GGGGTAGAGCTCACAGTGGGTGG + Intronic
1077900107 11:6481067-6481089 GAGACATAACTGACTGTGGAAGG - Intronic
1079230567 11:18645559-18645581 CAGGTAAATCTCACAGTGGAGGG + Intergenic
1081075807 11:38672314-38672336 TAGGCTGAACTAACTGTGGAAGG + Intergenic
1082806585 11:57455608-57455630 GGTGTGGAACTCACTGTGGAAGG + Intergenic
1083352762 11:62042674-62042696 GAAGTAGAACTGACTGTTGGAGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1085456308 11:76667348-76667370 GAGGGAGCACCCACTGTGGGAGG - Intronic
1087600760 11:100312375-100312397 GAGGCAGAACTCTCTTTCGAGGG - Intronic
1089891687 11:121887807-121887829 GAAGGAGAAGTCAATGTGGAGGG - Intergenic
1090062930 11:123479142-123479164 TCGGCAGAACTCACTGTGTACGG - Intergenic
1090105144 11:123845739-123845761 TAGGTATAAATCACTGTGGTAGG - Intergenic
1092236643 12:6814749-6814771 GAGTTGGCAGTCACTGTGGAGGG - Exonic
1092808521 12:12250214-12250236 TAGGTAGAAGTCATGGTGGAAGG - Intronic
1093323229 12:17739910-17739932 GAGGTTCAACTCACTGTTGCTGG - Intergenic
1093607327 12:21108543-21108565 GAGGAAGACATCACTGTGGTAGG + Intronic
1094223786 12:28023757-28023779 GAGGTGGAGATCACTGTGGGGGG + Intergenic
1094831297 12:34301481-34301503 GAGTTAGCAGTAACTGTGGAAGG + Intergenic
1094831586 12:34302715-34302737 GAGGTAGAGGCAACTGTGGAAGG + Intergenic
1094833771 12:34312759-34312781 GAGGTAGAGGAAACTGTGGAAGG - Intergenic
1094835108 12:34318638-34318660 GAGGTAGAGGCAACTGTGGAAGG - Intergenic
1094835956 12:34322199-34322221 GAGGTAGAGGTACCTGTGGAAGG - Intergenic
1094838074 12:34331529-34331551 GAGGTAGAGTCAACTGTGGAAGG - Intergenic
1097634130 12:62101639-62101661 GAAGTAGAACTTACTGTGTAGGG - Intronic
1100755608 12:97748132-97748154 TAGGTAAAACTAACTGGGGAAGG + Intergenic
1102002482 12:109566057-109566079 AAGGTACAACTCACCCTGGAGGG + Intronic
1104736801 12:131140033-131140055 GAGGCAAAACTCACAGCGGATGG - Exonic
1106220452 13:27742436-27742458 GAGGAAGAAGGCACTGTTGATGG - Intergenic
1106808279 13:33333635-33333657 GAGGAGGAACTCACTTAGGAGGG + Intronic
1109556764 13:63986521-63986543 GAGGTAGAGCCCACTGAAGAAGG - Intergenic
1112884959 13:104158892-104158914 AAGGTAGAACCCACTGTCAATGG - Intergenic
1113096747 13:106673440-106673462 GAGATAGACAACACTGTGGAGGG + Intergenic
1113119683 13:106912972-106912994 GAAGCAGAATTCACTGTAGAAGG + Intergenic
1114380810 14:22201555-22201577 GAGGTAGAAGTAACTATGAAGGG - Intergenic
1115698732 14:35927430-35927452 GAGATAAAACTCACTGTTTATGG - Intronic
1115977415 14:39012293-39012315 GAGCTTGTACTCACGGTGGAAGG - Intergenic
1120240989 14:81949328-81949350 GAGGTAGAACTTACGGGGCATGG - Intergenic
1120685793 14:87535571-87535593 GAGGTAGAGCAAACTGTGAAAGG - Intergenic
1122374844 14:101250869-101250891 GAGCCAGCACTCACTGGGGATGG + Intergenic
1123956072 15:25336010-25336032 GGGGTAGATATCACTGTGAAAGG - Intronic
1125465210 15:39944266-39944288 GTGGCACAACTCTCTGTGGAAGG + Intronic
1127366824 15:58299258-58299280 GAGCCAGAACTCACTAGGGAAGG - Intronic
1128742207 15:70091695-70091717 GAGGTTAAACTCACTGTGGCTGG - Intronic
1129650588 15:77484807-77484829 AAGCTAGAACTCACTGTCTATGG + Exonic
1131380835 15:91962623-91962645 GAGGTGGAAATGGCTGTGGAAGG + Intronic
1133084901 16:3354636-3354658 GAGGTAAAACTCAGAGGGGAGGG + Intergenic
1134635165 16:15786361-15786383 GAGGAAGATCTCGCTATGGAAGG + Intronic
1140200009 16:72887498-72887520 GAGGAAGGACTGAGTGTGGAGGG + Intronic
1140342195 16:74175246-74175268 GCTGTAGAACACACTGGGGAAGG + Intergenic
1144649787 17:17000087-17000109 GAGGTGGAAATGAGTGTGGAGGG + Intergenic
1145736936 17:27239796-27239818 GAGCAGGAACTCACTGTGCATGG - Intergenic
1151186383 17:72367187-72367209 GAGGTCAAACTCAGTGAGGAGGG + Intergenic
1151496298 17:74460212-74460234 GAGGCAGAAGTCACAGGGGAGGG - Intergenic
1151672449 17:75578904-75578926 GAGGTGAAAGTTACTGTGGATGG + Intergenic
1152268539 17:79310308-79310330 GAAGTAAAACTGACTGTGAAGGG - Intronic
1155083279 18:22431236-22431258 GAGGAAGCACCCACTGAGGAAGG - Intergenic
1157213505 18:45763424-45763446 GGGACAGAACTCACTGAGGAAGG - Intergenic
1158615276 18:58981395-58981417 GTGGAAGAACTCACGGTCGAAGG - Intronic
1158981269 18:62764318-62764340 GAGGCAGAACCCAAAGTGGATGG - Intronic
1159075969 18:63682512-63682534 GAGCTAGAAGTCATTGTGGAGGG - Intronic
1159965826 18:74595345-74595367 TAGGCAGAACTAACTCTGGAAGG - Intergenic
1160346783 18:78138704-78138726 GAGGGAGAAATCACAGTTGAAGG - Intergenic
1160350970 18:78177957-78177979 GAGGTAGCACTCACTGTAGATGG - Intergenic
1160560979 18:79755619-79755641 CAGGGAGAAACCACTGTGGAAGG - Exonic
1162841985 19:13363557-13363579 GAGGGAAAACCCACTGGGGAAGG - Intronic
1163487350 19:17595956-17595978 CAGGTAACTCTCACTGTGGAGGG + Intergenic
1165316363 19:35058457-35058479 AAGATAGAAATCACTCTGGAAGG + Intronic
1165650272 19:37481840-37481862 GAGGTCAAACAGACTGTGGAAGG - Intronic
1165991701 19:39818931-39818953 AAGGCAGAACTCACTGTGATTGG - Intergenic
1167158345 19:47752630-47752652 GAGGCAGAGCCCACTGAGGAGGG - Intronic
925946973 2:8874255-8874277 GAGGTGGAACTCAGTGTTCAAGG + Intronic
927939061 2:27092459-27092481 GAGGGAGAGCCCACTGGGGAAGG + Intronic
928455149 2:31414006-31414028 CATGTAGAACTCACTGTGTGTGG + Intronic
928919007 2:36506464-36506486 CATGGAGAACACACTGTGGATGG - Intronic
930049797 2:47206083-47206105 GAGGGAGTGCTCAGTGTGGATGG + Intergenic
930841472 2:55851750-55851772 GAGATAAAACTCACTGTTTATGG - Intergenic
934539614 2:95162977-95162999 GAGCTTTCACTCACTGTGGAAGG + Intronic
936060971 2:109295550-109295572 GAAGGAGGTCTCACTGTGGAGGG + Intronic
936574789 2:113644012-113644034 GAGGTAGGACTAACTCTGGAGGG - Intergenic
937784648 2:125881918-125881940 GAGGTAGACCACAGAGTGGAGGG - Intergenic
938922552 2:136008480-136008502 GAGGAAGAAGCCACTGTGGAAGG + Intergenic
939472961 2:142648247-142648269 GAGTTAGAAAGCACTGAGGATGG + Intergenic
945971753 2:216237814-216237836 GAGGATGAACCCACTGTGGGAGG + Intergenic
945971758 2:216237833-216237855 GAGGATGAACCCACTGTGGGAGG + Intergenic
947370784 2:229443367-229443389 GAGGTGGAACTCGCTGGGGTGGG - Intronic
948322240 2:237079824-237079846 CAGGTAGAACTAATTGTGAAAGG - Intergenic
1169242328 20:3994339-3994361 GAGTTATAACTGACTGTTGATGG - Intronic
1171314660 20:24178779-24178801 GAAGTAGAGCACACTGTGGTGGG + Intergenic
1172160773 20:32866567-32866589 GAGGGAGAACCCCCAGTGGAGGG + Intronic
1173763721 20:45587380-45587402 TAGGTAAATCTCACAGTGGAAGG - Intergenic
1173860842 20:46282728-46282750 GGGGGAGAACTCACTGGGGGAGG - Intronic
1175406553 20:58736027-58736049 GCGGGAGAAGTCACTGGGGAAGG + Intergenic
1177847419 21:26306479-26306501 GATGTAGTACTCACTTTGGGTGG - Intergenic
1178111975 21:29377959-29377981 GAAGTAGAAGTTACTGTGGAAGG + Intronic
1178515898 21:33246882-33246904 GAGATAAAACTCACTGTCTATGG - Exonic
1181118671 22:20650591-20650613 GATGTAGAACGCATCGTGGAAGG - Intergenic
1181159132 22:20946748-20946770 AAAGAAGCACTCACTGTGGAGGG - Intronic
1183359249 22:37374956-37374978 GAGGTCGCACTCACAGTTGAAGG + Exonic
1184369063 22:44071017-44071039 GGGGTAGGAGTCACTGTGAAAGG + Intronic
1185425384 22:50766864-50766886 GAGGTAGGACTAACTCTGGAGGG + Intergenic
949682281 3:6527954-6527976 CAGCTAGACCTGACTGTGGATGG + Intergenic
950477541 3:13223485-13223507 GAGGCAGAACTCCTTGGGGATGG + Intergenic
952468740 3:33620910-33620932 AAGGTACAACTCTCTGAGGAAGG - Intronic
954257603 3:49417451-49417473 GAGGCAGAACTCACTGGGGGTGG - Exonic
955535105 3:59915207-59915229 GAGCGAGAATTCACTGTGGAGGG + Intronic
961365285 3:126395579-126395601 GAGGAAGAAACCACTTTGGATGG + Intronic
961563789 3:127749014-127749036 GAGGGAGCACTCCCTGGGGAAGG - Intronic
962344382 3:134608821-134608843 GAAGTAGAACTCATTGTAGCTGG + Exonic
965400936 3:168211314-168211336 GAGGCAGAAGTCAAGGTGGAGGG - Intergenic
966059850 3:175741501-175741523 GAGGCAGAACACACAGTAGATGG + Intronic
966292330 3:178374453-178374475 GAGCTTTTACTCACTGTGGAAGG - Intergenic
967303463 3:188038935-188038957 GAGGTTGAATGCACTGTGGTTGG + Intergenic
967739041 3:192985059-192985081 GAGTTCTAACTCACTGTAGAGGG + Intergenic
968315836 3:197724546-197724568 GATAAAGAGCTCACTGTGGAAGG - Intronic
970011543 4:11464912-11464934 GAGGTAGAACTATCTGTGGAGGG + Intergenic
971229758 4:24791643-24791665 CATGAAGAACTCAGTGTGGAGGG + Intronic
971961240 4:33489866-33489888 TAGGTAAAACTAACTTTGGAAGG + Intergenic
972169034 4:36322448-36322470 AGGGAAGACCTCACTGTGGAGGG + Intronic
974459761 4:62172328-62172350 GGGGCAGAACTCACTCTGCATGG + Intergenic
975240018 4:72046448-72046470 GAGGGATATCCCACTGTGGAAGG - Intronic
976272874 4:83248284-83248306 GAGGCAGAACTCACTGGGGGTGG + Intergenic
978438663 4:108711541-108711563 TAGGTAAATCTCACAGTGGAGGG + Intergenic
981409333 4:144410240-144410262 GAGGAAGCACTCACTGTCTAAGG + Intergenic
982172879 4:152678802-152678824 GAGGTAGAAAACAAAGTGGAAGG - Intronic
982724343 4:158889607-158889629 AAGCTAGAATTCACTGTGAAAGG + Intronic
985804097 5:2027679-2027701 GCTGTAACACTCACTGTGGAGGG + Intergenic
986354883 5:6914041-6914063 GAGGTAAAAGGCACTGTAGAAGG + Intergenic
986504851 5:8439145-8439167 GAGGTAAAACTCACTCCTGAGGG + Intergenic
989658774 5:43775741-43775763 GATGCAGAACTCAGTGTGTAAGG + Intergenic
990268901 5:54113558-54113580 AAGGCAGAAATCACAGTGGATGG + Intronic
992593466 5:78321023-78321045 GATGTAGAAAGCACTGTGGGAGG + Intergenic
992781609 5:80133147-80133169 GAGCTTTTACTCACTGTGGAAGG - Intronic
993067365 5:83115945-83115967 GAGGTAAAACTTTCAGTGGATGG + Intronic
994151150 5:96449175-96449197 GGGGCAGAAGTTACTGTGGATGG - Intergenic
997238112 5:132286866-132286888 GAGATAAAACTCACTGTTTATGG - Intronic
997257130 5:132437795-132437817 GAGGAAGAACCCAGTGTGTATGG + Intronic
999938829 5:156517835-156517857 AAGGAAGCACTAACTGTGGAAGG + Intronic
1005091225 6:22058897-22058919 GAGGTAGAAGTAAATTTGGAAGG - Intergenic
1005313374 6:24580634-24580656 GAGGTAGAAGTTAGAGTGGATGG + Intronic
1005414873 6:25589149-25589171 GAGAAAGAAGTCATTGTGGATGG - Intronic
1007746817 6:44048124-44048146 GAGGAAGGCCTCAGTGTGGAAGG + Intergenic
1009306973 6:62102988-62103010 CAGGTACAACTGCCTGTGGAAGG - Intronic
1011480670 6:87790583-87790605 GAGGAAGAGCTGAATGTGGAGGG + Intergenic
1015271429 6:131341398-131341420 TAGGTAGCTCTCACAGTGGAAGG + Intergenic
1016562636 6:145414142-145414164 AAGGCAGAACTGAGTGTGGAAGG - Intergenic
1018018513 6:159734543-159734565 TAGCTAGAACTACCTGTGGAAGG - Intronic
1019453448 7:1111848-1111870 GAGTGAGGACTCGCTGTGGATGG + Intronic
1030348989 7:108462233-108462255 GAAGACGAATTCACTGTGGAGGG + Intergenic
1031313247 7:120226238-120226260 GAGCTAGAACTCCCTATGGGAGG - Intergenic
1034291913 7:149939531-149939553 GAGGAAGAACTCCCTGAGAACGG - Intergenic
1037416805 8:18660006-18660028 AAGCGATAACTCACTGTGGAAGG + Intronic
1037621658 8:20568537-20568559 GAGGTTGATCTCTCTGTGTAAGG + Intergenic
1040594904 8:48827939-48827961 GAGGCAGCACTCAGTGTGGTCGG + Intergenic
1040932913 8:52753887-52753909 GAGATAAAACTCACTGTTTATGG - Intergenic
1041039944 8:53836706-53836728 TAGGTAGAACTCACAGTCCAAGG - Intronic
1043606291 8:82004487-82004509 GAGGTAGAACACAATGTGCAGGG + Intergenic
1043749039 8:83911949-83911971 GAGATAAAACTCACTGTTTATGG + Intergenic
1045477799 8:102568192-102568214 GAGGTAGAACCCCATGTGGTTGG + Intergenic
1045989300 8:108286986-108287008 AAGGTTAAAGTCACTGTGGATGG - Intronic
1047070426 8:121336880-121336902 GAGGGAGAACTATCTGTGGATGG + Intergenic
1047701912 8:127457185-127457207 GAGGTGGGAATCACTGTGGGTGG - Intergenic
1048567572 8:135618926-135618948 TAAGTAGTACTGACTGTGGAGGG + Intronic
1048764183 8:137828010-137828032 TAGGTAGCTCTCACAGTGGAGGG - Intergenic
1049635922 8:143689409-143689431 GAGGCAGGACCCACTGTGGCAGG + Intronic
1050319466 9:4436408-4436430 GAGATTGAATTCACTTTGGAGGG - Intergenic
1052122960 9:24739644-24739666 GAGGTACGAATAACTGTGGATGG + Intergenic
1057297434 9:93857528-93857550 GAGGGAGAAGTCACTGGAGATGG - Intergenic
1059202589 9:112431740-112431762 GAGCTTGTACTCACGGTGGAAGG - Intronic
1061320055 9:129823238-129823260 GAGGCAGAACCCACTTCGGAGGG + Intronic
1188616888 X:32168336-32168358 GAGGTAGAGCTCACATTGGTAGG - Intronic
1193224101 X:78961231-78961253 GAGGCAGAAAGCACTGCGGATGG + Exonic
1196500245 X:116372577-116372599 AAGGTAGACCTCACTGCAGAAGG + Intergenic
1197354946 X:125427140-125427162 GATGGAGAATTCACTATGGATGG + Intergenic
1198169273 X:134089897-134089919 GAGGTTTTACTCATTGTGGAAGG + Intergenic
1198213504 X:134536104-134536126 GAGGCACAACTCAATGTGGTAGG + Intergenic
1198586375 X:138126957-138126979 GAGATAAAACTCACTGTTTATGG - Intergenic
1199989111 X:152974670-152974692 CAGGTAGAAGGCACTGTGCAAGG - Intergenic