ID: 923448486

View in Genome Browser
Species Human (GRCh38)
Location 1:234094594-234094616
Sequence GTCTAACCATTAGTGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923448484_923448486 -3 Left 923448484 1:234094574-234094596 CCATTATTAGGTTGGACACTGTC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 923448486 1:234094594-234094616 GTCTAACCATTAGTGGAACTAGG 0: 1
1: 0
2: 0
3: 7
4: 70
923448479_923448486 24 Left 923448479 1:234094547-234094569 CCATGGAAACAGCATGTGATTGA No data
Right 923448486 1:234094594-234094616 GTCTAACCATTAGTGGAACTAGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923448486 Original CRISPR GTCTAACCATTAGTGGAACT AGG Intronic
908479511 1:64524105-64524127 GTTTAACCATTACGGGAAGTTGG - Intronic
911667560 1:100571299-100571321 GTATAACCAGTAATGGGACTGGG - Intergenic
921705408 1:218317022-218317044 GTTCAACCATAAGTGGAAATGGG - Intronic
922645705 1:227284645-227284667 TTCTAACAGTTAGGGGAACTTGG - Intronic
922854260 1:228760662-228760684 TTCTAGCCATTAGTTGAACTTGG - Intergenic
923448486 1:234094594-234094616 GTCTAACCATTAGTGGAACTAGG + Intronic
923937783 1:238782964-238782986 GTCTAATCAGGAGTTGAACTGGG + Intergenic
1063182346 10:3615666-3615688 TTTCTACCATTAGTGGAACTGGG - Intergenic
1067773769 10:49146356-49146378 GTCTGAGCATTAGTGTTACTGGG - Intergenic
1068178216 10:53489223-53489245 GTATCACCATTATTGAAACTAGG + Intergenic
1068546948 10:58358308-58358330 TTCTAAACATTAGTGTAAATGGG - Intronic
1068864182 10:61877828-61877850 GTCTGACAATGAGAGGAACTTGG - Intergenic
1081447724 11:43146566-43146588 GTTTAACCATTAGGGGAAACAGG + Intergenic
1082127780 11:48453319-48453341 GTCTGTCCATTATTAGAACTCGG + Intergenic
1082819347 11:57533661-57533683 ATTTAACCTTTAGTGGAAGTTGG + Intergenic
1087292353 11:96333770-96333792 GTCTAACCTTTTGTGGCTCTAGG + Intronic
1087661106 11:100988712-100988734 GTGTACCCATCAGTGGAACCAGG + Exonic
1089293984 11:117457248-117457270 GTATAACCATGAGTGGCTCTGGG + Intronic
1090200099 11:124847817-124847839 GTATAACCAACAGTGGAATTAGG - Intergenic
1092139778 12:6175457-6175479 GTATAACCATTACAGGAATTTGG + Intergenic
1099935997 12:89126126-89126148 TTCTTGCCATTTGTGGAACTAGG - Intergenic
1102613039 12:114129260-114129282 GACTAACCATCCCTGGAACTGGG + Intergenic
1104759949 12:131291152-131291174 ATCTATCCATTATTGGAAATGGG + Intergenic
1104819774 12:131669146-131669168 ATCTATCCATTATTGGAAATGGG - Intergenic
1107628376 13:42315899-42315921 CTCTAACCATTAGTGAAAAGGGG - Intronic
1112088475 13:96055432-96055454 GTCTAAATATGAGTGGAAATGGG - Intergenic
1112089442 13:96067534-96067556 GTCTATACATTAGGGAAACTTGG - Intergenic
1112801432 13:103114303-103114325 ATCTTACCTTTACTGGAACTAGG + Intergenic
1115686604 14:35802981-35803003 GTCTAAAGATTAGTTGAGCTTGG - Intronic
1119612389 14:76074622-76074644 GTATAACCTTCAGTGGACCTGGG + Intronic
1124092104 15:26615261-26615283 GTCAAACCATTTAAGGAACTAGG - Intronic
1127172566 15:56318051-56318073 TTCTATCCATTATTGAAACTGGG + Intronic
1130844161 15:87728703-87728725 CCCTAACCATTAGTGTGACTGGG + Intergenic
1140805117 16:78526172-78526194 GTTTCACCAGTAGTGGAGCTAGG + Intronic
1147026778 17:37592888-37592910 GTTTTACCAATAGGGGAACTGGG + Intronic
1153947978 18:10033353-10033375 TTCTAACCTCTTGTGGAACTAGG + Intergenic
1155548995 18:26945285-26945307 ATGTTACCATTAGGGGAACTGGG - Intronic
1156963122 18:43057035-43057057 GTCTAACCATTAGTCGGGCGGGG + Intronic
1159501841 18:69281679-69281701 ACATAATCATTAGTGGAACTTGG + Intergenic
929689720 2:44064176-44064198 TCGTAACCATTAGAGGAACTGGG + Intergenic
931695625 2:64868569-64868591 GGCTAACTATTAGAGGTACTAGG - Intergenic
944696196 2:202202387-202202409 GTTTAATCATTATTGGAATTGGG + Intergenic
947291877 2:228584771-228584793 TTCTAACCATTAGAAGAGCTGGG - Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1175250730 20:57608895-57608917 TTCTACCCATTGGTGGGACTGGG + Intronic
1175672242 20:60914287-60914309 GTCTATCCATTATTGAAAGTGGG + Intergenic
1177901669 21:26924609-26924631 GTGTAACCCTTACTGGAAGTAGG + Exonic
1182159356 22:28106119-28106141 GTCTAAGCGGTAGTGGAAATTGG - Intronic
949313365 3:2724948-2724970 GTCCAACCTTTTGTGGGACTGGG - Intronic
953437816 3:42893222-42893244 ATCTATCCATTATTGGAACTGGG - Intronic
953535360 3:43773258-43773280 GTCTAACTATGAGTGGGACTGGG - Intergenic
956002249 3:64741759-64741781 GTCCAACCAGAAGTGGAATTTGG - Intergenic
960850615 3:122049448-122049470 TTCTAACCTTTATTGGAACTAGG + Intergenic
964944687 3:162205982-162206004 TTCTAACCATTAGTGTCAGTGGG + Intergenic
976510292 4:85900834-85900856 GTTCAAACATGAGTGGAACTTGG - Intronic
980572089 4:134632568-134632590 GTTTAACTATTAGTGAATCTGGG - Intergenic
982431617 4:155328551-155328573 GTCTATTCATTAGTGATACTGGG + Intergenic
991253818 5:64593183-64593205 GTGGAACCTATAGTGGAACTCGG - Intronic
996696261 5:126399168-126399190 CTCTATCCATTAGTGTAAGTGGG + Intronic
1006714546 6:36107915-36107937 GTTTTACAATTAGTAGAACTGGG + Intronic
1013305633 6:108844552-108844574 GTTTAACAATCACTGGAACTGGG - Intergenic
1014851762 6:126349247-126349269 ATGTAACCATTGGGGGAACTGGG - Intergenic
1017932266 6:158967653-158967675 GTCTATCCATTATTGAAAGTGGG + Intergenic
1024374381 7:48620661-48620683 GTCTAACTATTATTGTAACTAGG - Intronic
1044378222 8:91501237-91501259 GTATCACCTTTTGTGGAACTTGG - Intergenic
1046919568 8:119713937-119713959 TTCTATCCATTATTGGAAGTGGG + Intergenic
1047721248 8:127642136-127642158 GTCCTATCATTAGTAGAACTAGG + Intergenic
1048562949 8:135562179-135562201 CACTTACCATGAGTGGAACTTGG - Intronic
1056709557 9:88979759-88979781 GTGTAACCATTGGAGGAACTGGG - Intergenic
1060392644 9:123290977-123290999 GTTTAACCTTTTGAGGAACTGGG + Intergenic
1061006265 9:127929953-127929975 GTCTCACAAGTAGTGGAAGTGGG - Intronic
1186346527 X:8699571-8699593 GTGTAACCATTGGTGGAAACTGG + Intronic
1186931477 X:14395722-14395744 GGCTAACCATTTGTTGAACAGGG - Intergenic
1188920045 X:35962395-35962417 TTCTAATCATTATTGGAAGTGGG + Intronic
1188944619 X:36283791-36283813 GTCTGCCCATTTGTGGAACAGGG - Intronic
1197193415 X:123674146-123674168 TTCTAACCATTAATGAAAGTAGG + Intronic
1201892155 Y:18954395-18954417 CTCAAACCATGAGTGGAGCTTGG + Intergenic
1202591556 Y:26489410-26489432 GTCTAACTATTAATGGAAGTGGG - Intergenic