ID: 923448837

View in Genome Browser
Species Human (GRCh38)
Location 1:234097657-234097679
Sequence CTGTGGGAATTAAGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 376}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923448829_923448837 21 Left 923448829 1:234097613-234097635 CCTCATCTGGGGGAGAAGTCATG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG 0: 1
1: 0
2: 2
3: 28
4: 376
923448828_923448837 22 Left 923448828 1:234097612-234097634 CCCTCATCTGGGGGAGAAGTCAT 0: 1
1: 0
2: 0
3: 13
4: 133
Right 923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG 0: 1
1: 0
2: 2
3: 28
4: 376
923448832_923448837 -5 Left 923448832 1:234097639-234097661 CCTGAGCTAAGATAATGGCTGTG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG 0: 1
1: 0
2: 2
3: 28
4: 376
923448827_923448837 25 Left 923448827 1:234097609-234097631 CCTCCCTCATCTGGGGGAGAAGT 0: 1
1: 0
2: 0
3: 8
4: 193
Right 923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG 0: 1
1: 0
2: 2
3: 28
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923448837 Original CRISPR CTGTGGGAATTAAGAGGAGG AGG Intronic
902196996 1:14805184-14805206 CTGTGAGAGTCCAGAGGAGGTGG + Intronic
902559150 1:17266269-17266291 CCCTGGGAGTTAAGAGGAGAAGG + Intronic
903448801 1:23438835-23438857 CTGTGGGAATTTAGGGGCGGAGG + Intronic
905922068 1:41726477-41726499 CTGTGGGACTTAACATGAGCGGG - Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907517226 1:55000441-55000463 CTGTGTGAGTTAGGAGGGGGGGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
909070602 1:70988947-70988969 CTTTGGGAGTTAACATGAGGAGG + Intronic
909127502 1:71692629-71692651 CACTGGGGAGTAAGAGGAGGAGG - Intronic
910655377 1:89612974-89612996 CTGTGGGAGGTAAGAGCAAGTGG + Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
911163757 1:94707702-94707724 GAGTGTGAAGTAAGAGGAGGAGG + Intergenic
912302645 1:108533929-108533951 CTGAGACAATGAAGAGGAGGAGG - Intergenic
912329061 1:108800521-108800543 CTATGTGAAGGAAGAGGAGGTGG - Intronic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
913288410 1:117249414-117249436 ATGTGGGAGTTAACTGGAGGGGG + Intergenic
913322417 1:117598342-117598364 CTGTGGGGTTTCAGAGCAGGAGG - Intergenic
913679620 1:121176803-121176825 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914031454 1:143964450-143964472 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914157993 1:145103514-145103536 CAATGGGAGTTGAGAGGAGGAGG + Intronic
914322496 1:146578629-146578651 TTGGGGGAATTAACAGGAGTGGG - Intergenic
915516028 1:156413221-156413243 CTGTGGGAACAGAGAAGAGGAGG - Intronic
916070740 1:161168250-161168272 TTTTGGGAATTATGAGGGGGTGG - Intronic
920212533 1:204338778-204338800 CTGTGGAAATGAAGGGGATGGGG + Intronic
920466926 1:206195347-206195369 CAATGGGAGTTGAGAGGAGGAGG - Intronic
921749462 1:218775775-218775797 CTGTGCGAATGAGGGGGAGGGGG + Intergenic
922092060 1:222405211-222405233 CTGTGGGAATAAGAAGGAGCCGG + Intergenic
923275065 1:232388352-232388374 CTCTGGGGAGAAAGAGGAGGAGG + Intergenic
923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG + Intronic
1062878447 10:959775-959797 AGGTGGGAATGACGAGGAGGTGG - Intergenic
1062878451 10:959792-959814 AGGTGGGAATGACGAGGAGGTGG - Intergenic
1062878455 10:959809-959831 AGGTGGGAATGACGAGGAGGTGG - Intergenic
1062878459 10:959826-959848 AGGTGGGAATGACGAGGAGGTGG - Intergenic
1063369442 10:5511651-5511673 CTGCGGGAAGAAAGAGGCGGAGG - Intergenic
1063658987 10:8020370-8020392 CTGTGGGAATACAGCGGTGGAGG + Intergenic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1067993670 10:51244490-51244512 CAGGGGGAATTGGGAGGAGGAGG - Intronic
1070354038 10:75621630-75621652 CTGTGGGGAGCAAGAGGGGGAGG + Intronic
1072234138 10:93438652-93438674 CTGTGGGAGTAAAGTGGAGGAGG + Intronic
1073156819 10:101354078-101354100 CGGGGGGAAGGAAGAGGAGGCGG + Exonic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1074222737 10:111454258-111454280 ATGTGGGGAATAGGAGGAGGAGG + Intergenic
1075397984 10:122141499-122141521 CTGTGGGTGTTAAGGGCAGGCGG + Intronic
1075704408 10:124491243-124491265 GTGTGGGAATTCCGAGGCGGTGG + Intronic
1077464561 11:2727480-2727502 CTCGAGGAATAAAGAGGAGGAGG + Intronic
1077663621 11:4090154-4090176 TTGTGGGAATGAAGATGATGAGG - Intronic
1078171944 11:8934678-8934700 CAGTGGGATTTCAGTGGAGGAGG + Intergenic
1078603201 11:12751437-12751459 CTGTGGGAACACAGAGGAGTGGG + Intronic
1078841498 11:15079782-15079804 CTATGGGAATAAAGAGAAGAAGG + Intronic
1079407005 11:20156408-20156430 CCCTGGGAACGAAGAGGAGGAGG - Exonic
1079617337 11:22511723-22511745 CTGTGTGACATAAGAGAAGGAGG + Intergenic
1080329640 11:31120910-31120932 CCATGGGGATGAAGAGGAGGAGG + Intronic
1081693782 11:45095310-45095332 CTGGAGGAAATAAAAGGAGGAGG - Intergenic
1081871962 11:46387068-46387090 CTCAGGGAAGCAAGAGGAGGAGG + Intergenic
1083314593 11:61806595-61806617 CTGAGGGAATGAGGAGGATGTGG - Intronic
1084214687 11:67640928-67640950 CTGGGGGATGTAAAAGGAGGAGG + Intergenic
1084857029 11:71995989-71996011 CTGTGAGGAGGAAGAGGAGGGGG + Intronic
1084905418 11:72342530-72342552 CTGTGGGGATAAGGAGGAGTAGG - Intronic
1085031052 11:73271105-73271127 CTGTAAGAAAGAAGAGGAGGAGG + Intronic
1085430846 11:76445924-76445946 CTATGGGAAGTAGGGGGAGGGGG + Intronic
1085553267 11:77395205-77395227 CTTTGGGAATATGGAGGAGGGGG - Intronic
1085767963 11:79300071-79300093 CTGAGGGAAGCCAGAGGAGGGGG - Intronic
1086071689 11:82806412-82806434 CTGTAGGAATCACGTGGAGGAGG - Intergenic
1087078721 11:94150040-94150062 CTGTGGGAAGTCAGTGGGGGAGG + Intronic
1087134294 11:94699869-94699891 CTGTGGGAAGGAAGATGATGTGG + Intergenic
1089396377 11:118138681-118138703 CTGTGGTAAATAACAGGATGGGG + Intronic
1089880135 11:121765808-121765830 CTGTGGGAAGAGAGAGGTGGAGG - Intergenic
1090763531 11:129857195-129857217 GTGTGGGAACTATGAGGCGGTGG + Intronic
1091034356 11:132219813-132219835 GGGTGGGAGTGAAGAGGAGGGGG - Intronic
1091952669 12:4607976-4607998 TTCTGGGAATTATGAGGAGAGGG - Intronic
1092959286 12:13580591-13580613 CTGGGCTAATTATGAGGAGGTGG + Intronic
1094025354 12:25956087-25956109 CAGTGGCAATGAACAGGAGGAGG - Intergenic
1095946267 12:47755558-47755580 CTTTGGAAAATAAGAGGGGGAGG - Intronic
1096011867 12:48224581-48224603 CTGTGTGAATTCAGAAGAAGTGG + Intergenic
1096654634 12:53080890-53080912 ATGAGGGAATCAAAAGGAGGTGG - Intergenic
1097296009 12:57963763-57963785 TTGTGGGGAAGAAGAGGAGGAGG + Intergenic
1100055102 12:90499808-90499830 ATGTGAGAGTTAAAAGGAGGGGG - Intergenic
1100264771 12:92965277-92965299 GTGTGGGGGTTAAGGGGAGGGGG - Intergenic
1100371867 12:93975996-93976018 CCATGGGAATGAAGAGGAGTAGG - Intergenic
1101846160 12:108364808-108364830 CTGTGGGAGTTAAGAGAGGTAGG - Intergenic
1101976454 12:109363771-109363793 CTGGGAGAAGTCAGAGGAGGAGG + Intronic
1102146942 12:110661316-110661338 ATGGGAGAATGAAGAGGAGGAGG - Exonic
1103051350 12:117782628-117782650 CTGTGAGAATTACAATGAGGTGG - Intronic
1103361279 12:120355865-120355887 CTCTGGGAATTCAGAGGAGGGGG - Intronic
1103852328 12:123941230-123941252 CTGTGGGAATGCAGAGGAACAGG - Intronic
1104062552 12:125280864-125280886 ATTTGGGAGTTGAGAGGAGGGGG + Intronic
1104514534 12:129412515-129412537 CTGTAGGAAGAATGAGGAGGAGG - Intronic
1105572599 13:21617967-21617989 CTGTAGGAATAAAGTGGAGCTGG + Intergenic
1106153469 13:27129478-27129500 CTTTGGGAAGTCAGAGCAGGAGG + Intronic
1106758525 13:32845719-32845741 CTGTGGGGAATCAGAGGAGATGG - Intergenic
1110505482 13:76280940-76280962 CTGTGGAAATGAAGAGAAAGAGG - Intergenic
1111123478 13:83882327-83882349 CTTTCGGAATTACGTGGAGGGGG + Exonic
1111330870 13:86761130-86761152 CTGGGGGAATGAGGAGGAGGCGG + Intergenic
1111349498 13:87008138-87008160 CTGTAGTAATTAAGAGCATGTGG + Intergenic
1111460805 13:88539568-88539590 CTGGAAGAATTTAGAGGAGGAGG + Intergenic
1111752808 13:92356276-92356298 ATGTGGGAAATAAGAGTAGGAGG + Intronic
1112083618 13:96004438-96004460 ATGTGGGGATTAAGAGGGGATGG + Intronic
1112297354 13:98199763-98199785 GTGTGGGAATTCAGAGGGGCTGG + Intronic
1112346069 13:98590892-98590914 GTGTGGGAATTAAGGAGGGGTGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112628028 13:101128106-101128128 ATGTGGGAATAAAAAGGAAGGGG + Intronic
1112856641 13:103778794-103778816 CTATGGGAATTAACTGCAGGTGG - Intergenic
1114307027 14:21432796-21432818 GTGTGGGTATTTAAAGGAGGTGG - Intronic
1115689455 14:35827756-35827778 CTGTAGGAATTCAGAGGCAGAGG + Intronic
1117793355 14:59364423-59364445 CTGAGGGAGCTAAGAGGTGGTGG - Intronic
1118341928 14:64901341-64901363 ATCTAGGAATCAAGAGGAGGGGG - Intergenic
1119942220 14:78653034-78653056 ATGTGCGAATTGAGAGGAAGGGG + Intronic
1120215853 14:81679911-81679933 CTGTGGGACTTCAGAGGAAATGG + Intergenic
1120253905 14:82093516-82093538 CTGTGTGAGTTAAGTGGAGTAGG + Intergenic
1121849006 14:97202282-97202304 CAGTGAGAATGAAGAGGGGGCGG + Intergenic
1121925962 14:97927599-97927621 CTCTGGGAAAAATGAGGAGGTGG - Intronic
1122598015 14:102907077-102907099 CTGTGGTAATTAAGCAGCGGAGG - Exonic
1123159092 14:106260250-106260272 CTGAGGGAAGAGAGAGGAGGTGG - Intergenic
1123160211 14:106271088-106271110 CTGAGGGAAGAGAGAGGAGGTGG - Intergenic
1123207839 14:106730626-106730648 CTGAGGGAAGAGAGAGGAGGTGG - Intergenic
1124218789 15:27831897-27831919 CTATGGGGATAAAGAGGAGAAGG - Intronic
1124713567 15:32034984-32035006 CTGTGGGAATGTGGAGAAGGGGG + Intronic
1125684560 15:41556196-41556218 CAGCTGGAATCAAGAGGAGGAGG + Intergenic
1125771194 15:42167217-42167239 CTCTTGGAATTAAGAGGATAGGG - Intronic
1126713449 15:51486660-51486682 GTTTGGAAATTAAGAGGAAGTGG - Intronic
1126782323 15:52149483-52149505 CTGTGGGAATGAACACGTGGAGG - Intronic
1127368135 15:58310358-58310380 CTGTGTGGAGTGAGAGGAGGAGG + Intronic
1127623244 15:60754664-60754686 ATTTGGAAATTCAGAGGAGGTGG - Intronic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1129706230 15:77796054-77796076 CTGTGGGGAGAAAGAAGAGGTGG + Intronic
1129911082 15:79226965-79226987 GTCTGGGAACTAAGAGGTGGAGG + Intergenic
1130332555 15:82933554-82933576 CTGTGAGAATGATGAGAAGGTGG - Intronic
1131528416 15:93171481-93171503 CTGGGGCCATTTAGAGGAGGTGG + Intergenic
1132397560 15:101485746-101485768 CTCTGGGAAAGAAGAGGAGGAGG - Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133392758 16:5422788-5422810 GAGTGGGAAGAAAGAGGAGGAGG + Intergenic
1134258365 16:12630313-12630335 CTGAGGGAATTAAGGCTAGGGGG - Intergenic
1135862347 16:26068173-26068195 AAATGTGAATTAAGAGGAGGAGG - Intronic
1136466938 16:30450772-30450794 CTGTGGGACTTAAGAGTAGCAGG + Intergenic
1139008671 16:62605492-62605514 GTGTGGGATTCAAGAGGAGGTGG - Intergenic
1140011127 16:71132546-71132568 TTGGGGGAATTAACAGGAGTGGG + Intronic
1140182149 16:72730607-72730629 CTATGGGAATGAAAAGGAGGGGG + Intergenic
1140769603 16:78191224-78191246 CTGTGGGCCCCAAGAGGAGGGGG - Intronic
1141414525 16:83859966-83859988 CTTTGGGGCTTCAGAGGAGGAGG + Intergenic
1141680071 16:85538653-85538675 CTGTGGGGAGGAAGTGGAGGAGG + Intergenic
1142271501 16:89092043-89092065 CTGAGGGTATTAACAGGGGGTGG + Intronic
1142824568 17:2500617-2500639 CTATGGGAAGGAAGAGGAGCAGG - Intronic
1144098462 17:11922994-11923016 CTTTGGGAATTAAGTGAAGAGGG + Intronic
1144131501 17:12251142-12251164 CTGGGGGGATTAAGGGCAGGTGG + Intergenic
1146568665 17:33934860-33934882 CTGTGAGAATTGATAGGAGCTGG - Intronic
1149114612 17:53077606-53077628 CTGTGGAAATTGTGAGGGGGTGG + Intergenic
1149410321 17:56398347-56398369 GTGTAGTAATAAAGAGGAGGAGG - Intronic
1150243221 17:63652779-63652801 TTGTTGGAATTAAGAAAAGGGGG - Intronic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1154182035 18:12146283-12146305 CTGTGGGACTTTCCAGGAGGAGG + Intergenic
1155173592 18:23284894-23284916 CTGTGAGAGTTAAGAGGCAGGGG + Intronic
1156309014 18:35905666-35905688 CTGTGGGAATGAGGAGTAAGCGG + Intergenic
1156484029 18:37453525-37453547 CTATGGGATTTAAGAGAAAGGGG + Intronic
1156548205 18:37986943-37986965 GTGTGGGAATTGCAAGGAGGCGG - Intergenic
1156729196 18:40169893-40169915 CTGTGGCAAGGAGGAGGAGGAGG - Intergenic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1157525701 18:48379240-48379262 CTATGGTAATCAAGAGGGGGTGG - Intronic
1157591233 18:48837413-48837435 CTGCAGGAACTCAGAGGAGGAGG + Intronic
1158391719 18:57050312-57050334 CTTGGGGAACTGAGAGGAGGTGG - Intergenic
1159439228 18:68456093-68456115 ATGTGAGAATGAAGATGAGGTGG + Intergenic
1159964541 18:74582277-74582299 CTTTGTGAATAAAGAAGAGGTGG + Intronic
1160172481 18:76566617-76566639 CTGGGGGACTTCGGAGGAGGTGG + Intergenic
1161938026 19:7384029-7384051 TGGAGGGAATGAAGAGGAGGAGG + Intronic
1162555423 19:11383291-11383313 CTGCGGGAGGGAAGAGGAGGGGG - Intronic
1166348735 19:42183666-42183688 CTATGGGAGCCAAGAGGAGGTGG + Intronic
1166772671 19:45293820-45293842 CTGTGGGAACCCAAAGGAGGAGG + Intronic
1166956750 19:46470132-46470154 CTGTGTGAATAAGGAGGAGTTGG - Exonic
1168546192 19:57252300-57252322 CAGTTGGAATTAAGAGGATTTGG - Intronic
925073124 2:987177-987199 CTGTAGGAACTTAGAGGAGATGG + Intronic
925097279 2:1217000-1217022 CTGTGGGGAATATGAGCAGGGGG + Intronic
925842603 2:8006622-8006644 CTTAGAGAATTCAGAGGAGGAGG - Intergenic
925880691 2:8349950-8349972 CAGTGGGAATAAGGAAGAGGTGG + Intergenic
927071313 2:19532331-19532353 CTAAAGGAATTAAGAGGAGGAGG - Intergenic
928449494 2:31365852-31365874 CTGTGAGAATTCAAAGCAGGGGG + Intronic
928709033 2:33983696-33983718 TTGTGAGAATTAAGAGGTGATGG + Intergenic
928734835 2:34276102-34276124 ATGTGGGAATAAAGAGAAAGAGG + Intergenic
928790994 2:34952887-34952909 CTGTGGGAATTAGTATGGGGTGG + Intergenic
929331629 2:40689144-40689166 CAAAGGGGATTAAGAGGAGGTGG - Intergenic
929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG + Intronic
930876189 2:56219963-56219985 CTATGGGAACAAAGAGTAGGAGG + Intronic
931566025 2:63616369-63616391 CTGGGGGAATTAAGGGAGGGAGG + Intronic
931849956 2:66243193-66243215 TTGTGGTAATAAGGAGGAGGAGG + Intergenic
931850899 2:66249561-66249583 TTGTGGTAATAAGGAGGAGGAGG + Intergenic
932143111 2:69296966-69296988 CTGTGGGTGCTCAGAGGAGGGGG - Intergenic
932580590 2:72990502-72990524 CAGTAGCAATGAAGAGGAGGGGG + Intronic
934776748 2:96943772-96943794 CAGTGGGAACAAAGACGAGGTGG - Intronic
934882070 2:97991921-97991943 CTGTAAGAATTAGAAGGAGGAGG + Intronic
934942111 2:98510220-98510242 ATGTGGGATGTGAGAGGAGGAGG + Intronic
935411554 2:102769845-102769867 ATCTGAGAGTTAAGAGGAGGGGG + Intronic
935714014 2:105924276-105924298 GTCTGGGAATAAAGAGGAGATGG + Intergenic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
936980029 2:118255680-118255702 CTGGGGGGAGTGAGAGGAGGAGG - Intergenic
937851474 2:126639956-126639978 CAGTGGCAAGTAGGAGGAGGAGG - Intergenic
940946124 2:159620499-159620521 TTGTGAGAATAAAGAGGATGAGG + Intergenic
941660559 2:168191899-168191921 CTGTAGGAATCAAAGGGAGGAGG + Intronic
941719943 2:168802036-168802058 CTGTGGGATTTAGGGGGTGGGGG + Intronic
943683965 2:190796933-190796955 GTGTGGGAAGTCTGAGGAGGGGG + Intergenic
943971593 2:194415398-194415420 CTTTGGGATTTAAGAGGAAATGG + Intergenic
947246636 2:228055782-228055804 CTGTCGGAATTTGCAGGAGGAGG - Intronic
947651419 2:231789498-231789520 CTGTGAGGATGAAGAGGAAGGGG - Intronic
948272831 2:236687439-236687461 CAGTGGGGATTAAGAGGAGGTGG + Intergenic
948932141 2:241138732-241138754 CTGTGTGGATGAAGAGGATGCGG - Exonic
1170599744 20:17832051-17832073 CTGTGGGGATGAAGACGGGGCGG + Intergenic
1170732552 20:18987325-18987347 CTGTGGGAACTGAGAGGGAGTGG + Intergenic
1171187100 20:23130289-23130311 CGGTGGGCATTCTGAGGAGGTGG + Intergenic
1171379485 20:24723639-24723661 TTGTGGGAATTGAAAGGATGGGG + Intergenic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1172134779 20:32679643-32679665 CAGTGGGAGCTAAGGGGAGGAGG - Intergenic
1172510804 20:35499661-35499683 CTGTTGGAACTAGGAGGAGGGGG + Intronic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173985319 20:47256959-47256981 CTCTGTGAAATAAGAGGAGATGG + Intronic
1175345263 20:58268521-58268543 GGGTGGGAATGAAGAGGAGCGGG + Intergenic
1176162387 20:63654292-63654314 CTTTGGGAGTTATGAGGAGAGGG - Intergenic
1176892760 21:14338467-14338489 CTGTGAGAATTCAGAGCAAGGGG + Intergenic
1177772105 21:25528545-25528567 CTGTGAGGATAAAGAGTAGGAGG + Intergenic
1178003269 21:28188458-28188480 CTGCGGGATTTAGGGGGAGGTGG - Intergenic
1178029751 21:28510567-28510589 CTCAGGGAATTAACAGGTGGAGG + Intergenic
1180709783 22:17831923-17831945 GCCTGGGAATGAAGAGGAGGAGG - Exonic
1183104469 22:35606412-35606434 CTGTGGGAACCCAGAGGAGAGGG - Intergenic
1184402469 22:44282019-44282041 CTGTGGGGACCAAGAGGCGGGGG + Intronic
1184559743 22:45255278-45255300 CTGTGGGAGTGAAGAAGGGGAGG + Intergenic
1185346383 22:50312626-50312648 CTGTGGGGATTAACAGGCGGGGG + Intronic
949365156 3:3272599-3272621 CTGGGGGAGTGCAGAGGAGGGGG + Intergenic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950106590 3:10392651-10392673 CTGTGGGCAGTTAGAGGAGGTGG - Intronic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
951400182 3:22223529-22223551 CTGTGAGAATTAAATAGAGGTGG + Intronic
952901890 3:38116371-38116393 CTGGGGGTATGAGGAGGAGGGGG + Intronic
953451701 3:43011769-43011791 CTGTGTGAAGTCACAGGAGGAGG + Intronic
953451961 3:43013227-43013249 CTGTGGGAAGTCACAGGAAGAGG + Intronic
954536150 3:51360832-51360854 CTGTGGGAACATGGAGGAGGGGG + Intronic
954660856 3:52226159-52226181 CTCTGGGAATGTGGAGGAGGAGG - Exonic
954702293 3:52456566-52456588 CTGCGGGAACAAAGGGGAGGAGG - Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955070485 3:55568685-55568707 CTGTGAGAATAAACAGGATGGGG - Intronic
955684964 3:61540276-61540298 CTGTTGGAATAAGGGGGAGGAGG - Intergenic
955748164 3:62160537-62160559 CTGTGGGATGTCAGAGGAGCCGG + Intronic
955851381 3:63223733-63223755 CTATGGGAATATAGAAGAGGGGG - Intergenic
956272423 3:67462206-67462228 CTGTGGGAAGAAAAAGGAGCAGG - Intronic
956440942 3:69279799-69279821 AAGTGGGAAGGAAGAGGAGGAGG - Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956798896 3:72739305-72739327 CTGGGGGAAGGAAGATGAGGAGG - Intergenic
956991060 3:74766053-74766075 CTGTGGCAAGTAAGAATAGGTGG + Intergenic
957094450 3:75765653-75765675 CTGTGGGAAGCCAGGGGAGGTGG - Intronic
957931556 3:86884985-86885007 CTGTTGGATTTAAAATGAGGAGG + Intergenic
960423869 3:117482358-117482380 CTGTGGGACTTGAGAGGAAGAGG + Intergenic
960637398 3:119796831-119796853 CTTTGGGCATGAAGAGGAAGAGG - Intronic
960811885 3:121633938-121633960 CTGTAGGAACTATGAGGAAGGGG - Intronic
961543507 3:127616812-127616834 GAGTGGGAAGTGAGAGGAGGAGG - Intronic
961958178 3:130825845-130825867 CTCTGGGAATTGGGAGGAGGGGG + Intergenic
961999794 3:131284120-131284142 CTCTGGAAGTTCAGAGGAGGAGG + Intronic
962311144 3:134327619-134327641 CAGTGGGAAGGAAGAGGAAGAGG + Intergenic
963275322 3:143324281-143324303 CTGTGGGAATGGAGAGGGAGAGG - Intronic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
964211983 3:154238907-154238929 ATGAGGGAATTAAGGGGGGGAGG + Intronic
965513227 3:169592418-169592440 GTGAGGGCAGTAAGAGGAGGTGG - Intronic
966173416 3:177109479-177109501 CTATGGGAAGAAAGAAGAGGTGG + Intronic
966967331 3:185007174-185007196 CTGTGGGAAGGAGGAAGAGGGGG - Intronic
967943905 3:194787141-194787163 CTGTGGGAATGGAGAGGGAGGGG + Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
971044036 4:22784888-22784910 CAGTGGCAATGAAGAAGAGGAGG - Intergenic
975566844 4:75765888-75765910 CTGAGGGTATTAAGTGAAGGTGG - Intronic
975807803 4:78131402-78131424 GGGTGAGAATCAAGAGGAGGAGG - Intronic
976361834 4:84188424-84188446 CTGTGGAAACTCAAAGGAGGAGG - Intergenic
977601617 4:98939404-98939426 CAGTGAGAATGAAGAGGAGAGGG - Intergenic
980021479 4:127715100-127715122 CTATAGGAATTCTGAGGAGGGGG + Intronic
983930628 4:173449704-173449726 CTGTGAGAATTATGTTGAGGTGG + Intergenic
983996353 4:174187487-174187509 CTTTGGGAATTCAGGGGAAGAGG + Intergenic
984178175 4:176446104-176446126 ATGTTGGTATTAAGAGGTGGGGG + Intergenic
984999632 4:185471161-185471183 CGGAGGGAATTAGGAGGGGGCGG + Intronic
984999666 4:185471230-185471252 CGGAGGGAATTAGGAGGGGGCGG + Intronic
986664229 5:10086201-10086223 CTCTGAGAATTCAGAGGAGATGG + Intergenic
987066610 5:14296117-14296139 GTGTGGGAAGTGAGAGAAGGGGG + Intronic
987201981 5:15586401-15586423 CTTTGGGAAAGAAAAGGAGGGGG - Intronic
987316664 5:16730706-16730728 CTGTGAGAATTACTAGGTGGGGG + Intronic
987323439 5:16791290-16791312 CTGTGGGAATTAAGAGAAAATGG - Intronic
988679093 5:33466672-33466694 CTGAGGTAATAAAGAGGAGCTGG + Intronic
988852359 5:35192369-35192391 CTTAGAGAATTAAGAGGTGGGGG - Intronic
989804682 5:45588539-45588561 GTGTCGGCATTTAGAGGAGGGGG - Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991089892 5:62684169-62684191 GTATGGGAATGAGGAGGAGGAGG + Intergenic
991669416 5:69033020-69033042 CTGTGGGGATTAAGAGATGCAGG - Intergenic
992005442 5:72472926-72472948 CTGTGGGAGTTGAGAGGAAGGGG - Intronic
992107336 5:73460781-73460803 CAGTCGGAATTCAGAGCAGGTGG - Intergenic
992192404 5:74306576-74306598 ATGTTGGAAATAAGAGGAGAGGG - Intergenic
992880680 5:81106286-81106308 CTGTGAGAATGAAGAGGAAAGGG - Intronic
994097772 5:95862613-95862635 CTGTGGGAATAAAAAGCAGAGGG - Intergenic
995096825 5:108246167-108246189 CTTTTGAAATTATGAGGAGGGGG - Intronic
995730419 5:115234366-115234388 GTATGGGAGTTAAGAAGAGGGGG + Intronic
996187945 5:120502604-120502626 CTGTGGGAATTCAGAGGTCTTGG + Intronic
996964822 5:129295266-129295288 CTTTGGTAATTAATAGAAGGAGG - Intergenic
997804544 5:136903519-136903541 CTCTGGAAAATCAGAGGAGGAGG - Intergenic
999398181 5:151244138-151244160 CTGTAGGAGTCAAAAGGAGGTGG + Intronic
999517205 5:152313510-152313532 TGATGGGAATAAAGAGGAGGAGG - Intergenic
1000321678 5:160139337-160139359 CTGTGGGAAAGAGGAGGAAGTGG - Intergenic
1000329903 5:160198209-160198231 CTCAGGTAACTAAGAGGAGGGGG - Intronic
1000545431 5:162594439-162594461 CTCAGGGAATTAATAGGATGAGG - Intergenic
1001638693 5:173230603-173230625 CTGTGGGAAGGAAGAGGAAAGGG - Intergenic
1002364415 5:178698968-178698990 CTGTGGAAATGAAGAGATGGTGG - Intergenic
1002947640 6:1778462-1778484 CTGTGGAATTCAAGAGGAGGGGG + Intronic
1004296875 6:14420975-14420997 CTGTGGGAAAGCAAAGGAGGAGG - Intergenic
1004993309 6:21163287-21163309 CTGAGAGAATGAAGTGGAGGAGG - Intronic
1006423673 6:33950747-33950769 CTGTGATAATGAAGAGGATGGGG + Intergenic
1007207634 6:40165385-40165407 CTGTGGGAATACACAGAAGGTGG + Intergenic
1007208246 6:40170113-40170135 CAGTGGGCAACAAGAGGAGGAGG - Intergenic
1007811377 6:44488495-44488517 GGGTGGGGATTGAGAGGAGGGGG - Intergenic
1008494739 6:52121665-52121687 ATATGGGGATAAAGAGGAGGGGG - Intergenic
1009760664 6:68001332-68001354 CAGTGGGAGTGAGGAGGAGGTGG - Intergenic
1010649974 6:78442561-78442583 CAGTGGGATTTAGGATGAGGTGG - Intergenic
1011528139 6:88289294-88289316 CTGTGAAAATTAAGGAGAGGTGG + Intergenic
1013006910 6:106082264-106082286 CTGTGGGAAAGAACAGGAGAAGG - Intergenic
1013528807 6:111000395-111000417 CTGTGATAATTCAGAGGAAGAGG - Intronic
1013947532 6:115739183-115739205 CTGTGGAGATTAAAAGGTGGAGG + Intergenic
1015189915 6:130461157-130461179 CTGTGGGAGGAAAGAGTAGGAGG - Intergenic
1015696104 6:135981633-135981655 CTGTGGGAAAAATGTGGAGGTGG - Intronic
1018795220 6:167180071-167180093 CTGGGGGCCTGAAGAGGAGGGGG - Intronic
1018821100 6:167374991-167375013 CTGGGGGCCTGAAGAGGAGGGGG + Intronic
1019613768 7:1949614-1949636 CTGTGGGGTTTCAGGGGAGGTGG - Intronic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1019750038 7:2723553-2723575 CTGTCGGACTGAGGAGGAGGAGG + Intronic
1021830118 7:24598016-24598038 CTGTGGAAAATAAGAGGTGAGGG + Intronic
1022831144 7:34067937-34067959 CTGTGGGAATTGACAATAGGTGG - Intronic
1023123135 7:36929301-36929323 CCTAGGGAACTAAGAGGAGGTGG - Intronic
1024116146 7:46195721-46195743 CTGTGGGATATAAGAGCATGTGG + Intergenic
1024178139 7:46861781-46861803 CGGTGAGAGTTAAGAGGAGGAGG + Intergenic
1024224475 7:47315168-47315190 TTGTGGGAATTAAGGGCAGAAGG - Intronic
1024478347 7:49838168-49838190 CTGTGTGAATTAGGAGGCAGAGG + Intronic
1024585359 7:50837167-50837189 ATGTGGGAAGTTAGAGGATGAGG - Intergenic
1024843173 7:53611193-53611215 CAGTGGGAAGAACGAGGAGGAGG - Intergenic
1026218055 7:68366993-68367015 CTTTGGGAATTCAGAGGAAAGGG - Intergenic
1026852721 7:73735218-73735240 CTATGGAAAGGAAGAGGAGGTGG - Intergenic
1028014674 7:85692218-85692240 TTGTGGAAATTAAGATGATGAGG + Intergenic
1028382277 7:90212255-90212277 CTCTAGGAACCAAGAGGAGGAGG - Intronic
1029610092 7:101622201-101622223 CTGTGGGAGGTGAGAGGTGGGGG + Intronic
1029834677 7:103296856-103296878 CAGAGGGAACTATGAGGAGGTGG + Intergenic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032845480 7:135748286-135748308 CTGAGGGAATTAGGTTGAGGTGG - Intronic
1033258572 7:139822694-139822716 GTGTGGGGATGAAGAAGAGGGGG - Intronic
1033283486 7:140021998-140022020 CAGTGGGATTTAAGCAGAGGTGG - Intergenic
1033499349 7:141932138-141932160 CTGTGAGAATGAAGGGGAAGGGG + Intronic
1034447053 7:151119095-151119117 ATGTGGGAAAAAGGAGGAGGAGG + Intronic
1034461624 7:151200765-151200787 CTCTGGGGATTCTGAGGAGGGGG - Intronic
1034469203 7:151246649-151246671 CTGTGGAGACTGAGAGGAGGCGG + Intronic
1034978622 7:155461854-155461876 CTGTGGGAATCAGGGGCAGGTGG - Intronic
1035658546 8:1330129-1330151 CTGTGGGAGTGAGGAGGTGGTGG + Intergenic
1036618990 8:10410411-10410433 CTGTGGGAATTATGAGGTGATGG - Intronic
1037408019 8:18564738-18564760 CAGTGGGATTTCAGGGGAGGAGG - Intronic
1037492361 8:19408401-19408423 CTTTGGGAGGTTAGAGGAGGGGG - Intronic
1037700692 8:21271645-21271667 CTGTGGGAAAGGGGAGGAGGAGG - Intergenic
1037853185 8:22349692-22349714 CTTTGGGAATTAACAGGAACTGG + Intronic
1038426164 8:27465268-27465290 CTGTGGGAATTAGAAGGGGAGGG - Intronic
1038754622 8:30329136-30329158 CCGTAGGATTTCAGAGGAGGGGG + Intergenic
1038967924 8:32596231-32596253 CTGTAGGAAGTAAGAAGAGATGG + Intronic
1039934888 8:42033649-42033671 CTGTGGAAACACAGAGGAGGGGG - Intronic
1040617687 8:49055194-49055216 CTGTAGCAATTAGGAGCAGGAGG - Intronic
1042171153 8:65992490-65992512 CTGAGGGACATAAGAGGAGATGG + Intergenic
1042639044 8:70912380-70912402 TGGTGAGAATGAAGAGGAGGGGG + Intergenic
1043020166 8:74990415-74990437 GTGTGGGAAATAAGAGCATGGGG - Intronic
1044822979 8:96170149-96170171 CTGGGAGAAAGAAGAGGAGGCGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1046525606 8:115378582-115378604 CTATAGGTATAAAGAGGAGGAGG + Intergenic
1046575247 8:116020031-116020053 CTCTAGGAAATAAGAGGAGTTGG + Intergenic
1047019058 8:120755379-120755401 CTTGGGGATTTCAGAGGAGGAGG + Intronic
1047440410 8:124872529-124872551 CTGTGGGAATTGTGTGGTGGTGG + Intergenic
1048219050 8:132524792-132524814 CTGGAGGGATGAAGAGGAGGCGG - Intergenic
1048284450 8:133130915-133130937 CTGGAGGAAGAAAGAGGAGGGGG + Intronic
1049199596 8:141333555-141333577 GTGTGGGAGGGAAGAGGAGGAGG + Intergenic
1050882686 9:10722566-10722588 ACGTAGGAATTTAGAGGAGGAGG + Intergenic
1052605231 9:30690176-30690198 CTGTAGGAATCACGTGGAGGAGG - Intergenic
1053543393 9:38997956-38997978 TTGTGGGAATTCAGAGAATGGGG - Intergenic
1055693456 9:78858222-78858244 CTATGGGAATTAGGTGGAAGAGG + Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057523944 9:95783525-95783547 CAGTGAGACTTAAGGGGAGGGGG + Intergenic
1057821054 9:98331452-98331474 CTGTGGAAACGCAGAGGAGGTGG - Intronic
1057904907 9:98975798-98975820 CTGTGGATGTTTAGAGGAGGGGG + Intronic
1059057909 9:111003757-111003779 TTGTGGGAGTTAAGGGGAGATGG + Intronic
1059433640 9:114264217-114264239 GTGTGGGAAGTGGGAGGAGGAGG + Intronic
1059554281 9:115263223-115263245 CTGTGGGAACACAAAGGAGGGGG + Intronic
1059897227 9:118879930-118879952 CTTTGTGAATGAAGAAGAGGTGG - Intergenic
1059956496 9:119521484-119521506 CTGTGGAAGTCCAGAGGAGGCGG - Intronic
1060229630 9:121817270-121817292 ATGTGGGAATGAAGGGGAGGTGG + Intergenic
1060509731 9:124223298-124223320 CTGTGGGGAGTCAGTGGAGGAGG - Intergenic
1061009582 9:127947023-127947045 GTGTGGCAATTAGGAGGAGGGGG - Intronic
1061577235 9:131514643-131514665 GTGTGTGGATTAAGAGGAAGTGG + Intronic
1062627718 9:137450742-137450764 TGGGGGGAATTAAGAGGAAGAGG - Intronic
1187899532 X:24014599-24014621 GTGGGGGAAAAAAGAGGAGGAGG + Intronic
1188644320 X:32545586-32545608 CTGTAGGAAATAAGGGGTGGGGG + Intronic
1190004254 X:46719733-46719755 TTGTGGAAATTAGGGGGAGGGGG + Intronic
1191892263 X:65956371-65956393 CTGTAGGAATCACGTGGAGGAGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192493647 X:71598396-71598418 GTGTGGGAATGACGAGGAAGAGG + Intronic
1193794247 X:85853591-85853613 TCGTGGGAATAAAGAGGAGGTGG + Intergenic
1194622648 X:96192172-96192194 CTATTGGAATTAGGAGGTGGGGG - Intergenic
1196441170 X:115721432-115721454 GGGTGGGAATTACCAGGAGGTGG - Intergenic
1196444698 X:115839420-115839442 GGGTGGGAATTACCAGGAGGTGG - Intergenic
1197810173 X:130434271-130434293 GTGTAGTGATTAAGAGGAGGTGG + Intergenic
1198230151 X:134681284-134681306 CTTTGGTCGTTAAGAGGAGGGGG + Intronic
1198462166 X:136874224-136874246 CTGTAGGAATCACGTGGAGGAGG + Exonic
1198491130 X:137142650-137142672 CTGTGGAAATCCAGATGAGGTGG + Intergenic
1199296828 X:146168983-146169005 ATATGGGAATGAAGAGCAGGAGG - Intergenic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1200044759 X:153395600-153395622 CTGTGGGAAACTAGGGGAGGGGG - Intergenic
1200064451 X:153497792-153497814 CTGTGGGATTCAAGTGGTGGAGG - Intronic