ID: 923451875

View in Genome Browser
Species Human (GRCh38)
Location 1:234125611-234125633
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 302}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923451875 Original CRISPR CAGGGCAGTCAGCACAAGCC CGG (reversed) Intronic