ID: 923452742

View in Genome Browser
Species Human (GRCh38)
Location 1:234135082-234135104
Sequence GCATTTAAACAGGCTGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923452739_923452742 2 Left 923452739 1:234135057-234135079 CCAACAAGACAGAGAATGAGGAC 0: 1
1: 0
2: 3
3: 27
4: 247
Right 923452742 1:234135082-234135104 GCATTTAAACAGGCTGATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 171
923452736_923452742 14 Left 923452736 1:234135045-234135067 CCCAGGCAAGAACCAACAAGACA 0: 1
1: 0
2: 0
3: 17
4: 305
Right 923452742 1:234135082-234135104 GCATTTAAACAGGCTGATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 171
923452737_923452742 13 Left 923452737 1:234135046-234135068 CCAGGCAAGAACCAACAAGACAG 0: 1
1: 0
2: 2
3: 12
4: 144
Right 923452742 1:234135082-234135104 GCATTTAAACAGGCTGATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923452742 Original CRISPR GCATTTAAACAGGCTGATCA GGG Intronic
900313558 1:2046346-2046368 GCAGTTTAAGAGGCTGATGAGGG + Intergenic
902447721 1:16477579-16477601 GCCTTAAAACAGGCTGGGCACGG - Intergenic
903951896 1:27000511-27000533 ACATTTAAACATCCTGATAATGG + Exonic
905385198 1:37598283-37598305 GCAGATAAAAAGCCTGATCAAGG + Intergenic
905977189 1:42184735-42184757 CCATTTAAATAGGATGACCAAGG + Intronic
909731481 1:78896982-78897004 GCATTTAAACAGAGTGATGAGGG - Intronic
912587373 1:110779329-110779351 TGCTTTAAACAGGCTGGTCATGG + Intergenic
917427751 1:174933289-174933311 GCATTTTAACAGGGTGAAGAGGG - Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921807134 1:219468253-219468275 GATTTTATACAGGATGATCATGG + Intergenic
922714969 1:227864830-227864852 GGATTTAAAAAGACTTATCACGG + Intergenic
923452742 1:234135082-234135104 GCATTTAAACAGGCTGATCAGGG + Intronic
924922454 1:248644987-248645009 CCATTTAAATAGGCAGATAAAGG - Intergenic
1063900846 10:10731028-10731050 GCATTTTAACAGGCAAAGCAAGG - Intergenic
1064640614 10:17411981-17412003 CCATTTGAACAGGCTGGCCATGG - Intronic
1064969023 10:21044705-21044727 GCATTTGAGCAGGGTGATAAAGG - Intronic
1071732111 10:88258540-88258562 GCATATAAACTGTCTAATCATGG + Intergenic
1073759617 10:106615509-106615531 TCATTAAAACTGTCTGATCATGG + Intronic
1073824880 10:107309244-107309266 GCATTTAAACCTGCCGGTCATGG + Intergenic
1074390146 10:113050304-113050326 GCATTTGAAAAGGCTGAAGAAGG + Intronic
1076557031 10:131332629-131332651 GCTTTTAAACTGGCTGCTCTAGG + Intergenic
1077974858 11:7237498-7237520 GCATTTAGACAGGGTCAACATGG + Intergenic
1079341281 11:19613523-19613545 TCATTTCAACAGTCTGATTAGGG - Intronic
1079359235 11:19756763-19756785 GGAGTTAAAAAGGCTGATCAGGG + Intronic
1079421916 11:20301290-20301312 ACTTCTAGACAGGCTGATCAAGG - Intergenic
1079928691 11:26530058-26530080 GCATTTTAACAAGATAATCAAGG + Intronic
1080834171 11:35925182-35925204 GCATTGAAATGTGCTGATCAAGG + Intergenic
1083975919 11:66119987-66120009 GCATTTAGATAAGCTGCTCAAGG - Intronic
1084513444 11:69620951-69620973 GCATTTTAGCAGGCTGAGGAGGG - Intergenic
1085475411 11:76785724-76785746 GGATTTAAACAGGCACAGCAGGG + Intronic
1085943820 11:81241297-81241319 GCATTTCAACAGGCAGTCCAGGG + Intergenic
1087520481 11:99227534-99227556 TCATTTCAACATGCTGATAAAGG + Intronic
1087646865 11:100818209-100818231 GCATTTATACATGCTGGTCCAGG - Intronic
1088053109 11:105542650-105542672 GAAGTTAAACAGCCTGTTCATGG - Intergenic
1091117430 11:133026941-133026963 TTATTTTAACAGACTGATCATGG + Intronic
1092976078 12:13746139-13746161 CCTTTTAAACAGAGTGATCAGGG + Intronic
1098144320 12:67483621-67483643 GCATTTGAACAGGCTGCTGTTGG + Intergenic
1098418002 12:70258721-70258743 AGATTTAAATAGGCTGGTCAGGG + Intronic
1099987533 12:89685109-89685131 GCAATTTAGCAGGATGATCAAGG + Intronic
1100889953 12:99114459-99114481 GAATTTAAACAGGGTGGGCATGG + Intronic
1102359216 12:112269180-112269202 GGTTTTAAACAGGTTGATAAAGG + Intronic
1102739934 12:115198185-115198207 ACATTTAAACAGGCTCACCCTGG + Intergenic
1103805910 12:123572665-123572687 GGACTTGAGCAGGCTGATCAAGG + Intergenic
1106212114 13:27659210-27659232 GTATGTTAAGAGGCTGATCATGG + Intronic
1106265113 13:28102621-28102643 GCAATGAAACAGGCTGGTTATGG + Intergenic
1108845243 13:54670424-54670446 GCATTTAATTAATCTGATCATGG + Intergenic
1111183946 13:84704411-84704433 GAATTTAAAAAAGCAGATCATGG + Intergenic
1112118931 13:96388158-96388180 GCATTTAAAGAGCTTAATCATGG + Intronic
1113047868 13:106175104-106175126 GTATTTAAACAGGGTGGCCAGGG - Intergenic
1115463581 14:33688780-33688802 TCATTTACACAGGCAGAGCATGG + Intronic
1118249181 14:64142420-64142442 GCATGTACACAGGATGATAAGGG - Intronic
1118353418 14:64990724-64990746 GCATTTTAACAGGCTCATTTAGG + Intronic
1118712112 14:68528511-68528533 GAATTTTAACAGGCTGATCATGG - Intronic
1118728517 14:68649928-68649950 GCCTTAAGACAGGCTGACCAAGG + Intronic
1119737718 14:76994359-76994381 GCATTTAAAAATGCAAATCAGGG - Intergenic
1123102070 14:105811101-105811123 GCTTTTAAACAGCCAGATCTCGG + Intergenic
1128803847 15:70516066-70516088 GAACTTAAACAGGCTGGGCATGG + Intergenic
1130013872 15:80172969-80172991 GGACTTACAAAGGCTGATCAGGG - Intronic
1130688176 15:86057290-86057312 GATTTTAAACAGGATGATGATGG - Intergenic
1133645633 16:7761849-7761871 GCTTTTAAACAGCCAGATCTTGG + Intergenic
1137845251 16:51681454-51681476 GCAACCAATCAGGCTGATCATGG + Intergenic
1138767255 16:59618985-59619007 GAATTTAAATAGGCTGGGCATGG - Intergenic
1139049588 16:63107444-63107466 CATTTTAAACAGGGTGATCAGGG + Intergenic
1142148906 16:88504137-88504159 GCAAATGAACAGGCTGAGCAGGG + Intronic
1142728504 17:1833878-1833900 ACTTTTAAAAAGACTGATCATGG + Intronic
1144633315 17:16887278-16887300 GCATTTTAACAGTATGAGCAGGG + Intergenic
1147906473 17:43826444-43826466 GCATTTTAACAAGATGCTCAGGG + Intronic
1150037129 17:61814928-61814950 GCAGTTGAACAGGCTGAGTATGG + Intronic
1155232028 18:23783369-23783391 CCATTTATACAGACTGGTCAGGG + Intronic
1159171499 18:64774498-64774520 GCATTTCAAGAGGCTGAGGAGGG - Intergenic
1159905235 18:74083792-74083814 ACATTTAAACAGTCTGCACATGG + Intronic
1161246774 19:3257121-3257143 CCATTTAGACAGGGTGGTCAGGG + Intronic
1162834363 19:13306631-13306653 GCTTTTAAAAAGCCTGCTCAGGG - Intronic
1167179482 19:47891651-47891673 GCAGGTAAACAGGCTGGGCACGG - Intergenic
1167554083 19:50182088-50182110 GCTTTTAAAAATGCTGAACAAGG - Intergenic
925900622 2:8506749-8506771 GCATCTTAACTGGGTGATCAGGG + Intergenic
926435922 2:12837828-12837850 GCATTTAAAAATGCATATCATGG + Intergenic
926771554 2:16381563-16381585 ACTTTTAAACAGGATGGTCAGGG + Intergenic
927549031 2:23980915-23980937 AAATATAAACAGGCTGAGCACGG - Intronic
930578254 2:53178891-53178913 GAATTTGAAGAGGATGATCAAGG - Intergenic
930686579 2:54314325-54314347 CAATTTAAATAGGGTGATCAGGG - Intergenic
933222664 2:79708469-79708491 ACATTTAAAGTGGCTGAACAGGG - Intronic
935061718 2:99614411-99614433 GCATTTACACAGACATATCAGGG + Intronic
935091965 2:99904168-99904190 GCATTTATACATGGAGATCAAGG - Intronic
935956718 2:108384113-108384135 GCATTTTAGCAGGCTGAGGAGGG - Intronic
939272499 2:139959074-139959096 GAATTTAAAAATGTTGATCAGGG - Intergenic
939645880 2:144698371-144698393 GCATTTAAAGAAGAGGATCATGG + Intergenic
943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG + Intergenic
943268104 2:185763441-185763463 ACATTTAAGCAGACTGTTCAAGG - Intronic
945744169 2:213700844-213700866 GCATTTAAAAAAGATGATCTAGG + Intronic
1169973165 20:11293239-11293261 GAATTAAAACAGGGTCATCATGG + Intergenic
1171959501 20:31483894-31483916 GCATTTAAACAAGCTCCTCCAGG + Intronic
1175629068 20:60517460-60517482 GGATTTAAAATGGCTGATAAGGG - Intergenic
1180659618 22:17454671-17454693 GTATTTGTACAGGCTCATCAAGG - Intronic
1180678696 22:17607747-17607769 GCATTTAAACCAGCAGCTCAGGG - Intronic
1180817392 22:18799619-18799641 GCAGTTCCACAGGCTGTTCAGGG - Intergenic
1181203582 22:21233940-21233962 GCAGTTCCACAGGCTGTTCAGGG - Intergenic
1182595196 22:31414095-31414117 ACATTTAAAGAGTCTGATGATGG - Intronic
1183501263 22:38181100-38181122 GCATGTGACCAGGGTGATCATGG - Intronic
1203223339 22_KI270731v1_random:61474-61496 GCAGTTCCACAGGCTGTTCAGGG + Intergenic
1203267490 22_KI270734v1_random:25346-25368 GCAGTTCCACAGGCTGTTCAGGG - Intergenic
950186298 3:10947764-10947786 AATTTTAAACAGGCTGGTCAGGG + Intergenic
950190616 3:10973928-10973950 CCATTGAAAAAGGCTGAACAGGG - Intergenic
951394978 3:22153913-22153935 ACATTTAAACATGCTAATCATGG + Intronic
953271772 3:41452456-41452478 GCAATTAAACAGTGTAATCAGGG + Intronic
953674653 3:44991409-44991431 GCATTGAATTAGGCAGATCAAGG - Intronic
953886397 3:46716816-46716838 TCCTTTAAAAAGGCTGGTCACGG - Intronic
954362018 3:50126987-50127009 GCATCGAAACAGGCTGGGCAAGG - Intergenic
955111694 3:55957222-55957244 CCATTTTATCAGGCTGAACAAGG - Intronic
956639141 3:71398488-71398510 GAATTTAAACAGGGTGAAAAGGG - Intronic
957225468 3:77439315-77439337 GGATTTGAACATGATGATCAAGG + Intronic
959413568 3:106056340-106056362 GCAGATAAATAGGCTGAGCACGG + Intergenic
960098373 3:113710258-113710280 GAATTTAAATAGACTGATCATGG - Intergenic
960803643 3:121562465-121562487 GCACATAAACAGGCTGAAAATGG + Intergenic
961442535 3:126961473-126961495 GCATTTCCACAGGCTGACCCGGG - Intergenic
963594518 3:147308657-147308679 GAATTTCAACAGGAAGATCAAGG - Intergenic
965098486 3:164267437-164267459 GTTATTAAACAGGCTGAGCATGG + Intergenic
966514926 3:180808956-180808978 ACTTTTAAACATGCTGACCAAGG + Intronic
967451481 3:189628577-189628599 TCATTTAAACAGGCAGGTCATGG + Intergenic
967965243 3:194955638-194955660 GCAGTGAAATAGGCTGAACACGG + Intergenic
970015379 4:11506768-11506790 GACTTTAAGCAGGATGATCAGGG - Intergenic
971254905 4:25005617-25005639 GCAGTTAAACAGGCTTCTCCTGG + Intronic
971827926 4:31651518-31651540 GCATTTAAATATGATGATTATGG + Intergenic
973033493 4:45374281-45374303 GCATTCAAACATGTTCATCATGG + Intergenic
973816438 4:54623612-54623634 TGATTTATACAAGCTGATCAGGG - Intergenic
974334769 4:60527883-60527905 GGATTTAATCAGGCTAAACATGG - Intergenic
976036633 4:80830883-80830905 ACTTGTAAAAAGGCTGATCAAGG + Intronic
976814668 4:89133760-89133782 GCAACTAATCAGACTGATCACGG - Intergenic
980228290 4:130015611-130015633 GCAGTTAAATTGCCTGATCAAGG - Intergenic
985127679 4:186711625-186711647 ACATATAAAGAGGCTGGTCACGG + Intronic
989783182 5:45294935-45294957 GCAGTTAAACAAGCTGGCCAAGG - Intronic
991139191 5:63219455-63219477 GCATTTAATTAAGCTGATAATGG - Intergenic
991601258 5:68353604-68353626 GTATTTAAACAGGAGGATAAGGG - Intergenic
994146513 5:96401607-96401629 AATTTTAAATAGGCTGATCAAGG - Intronic
995909369 5:117167444-117167466 GCTTTTACACTGGATGATCAAGG - Intergenic
996238093 5:121158823-121158845 GCATTTAAAAAGCCTGATGCAGG - Intergenic
999423269 5:151463564-151463586 GCCTTTTAACAGGTGGATCAAGG - Exonic
1001925552 5:175633633-175633655 TCATTTAGACAGGGTGGTCAGGG + Intergenic
1003175002 6:3747647-3747669 GCGTTTAGACAGGGTGATCGAGG - Intronic
1003851367 6:10226098-10226120 GCATTTAGACAAGGTCATCAAGG + Intergenic
1006690787 6:35883126-35883148 GCAATTAAATAGGCTGGGCATGG + Intronic
1006845268 6:37057150-37057172 GCCTTTAAATAGGGTGTTCAGGG + Intergenic
1008743082 6:54633760-54633782 GGATTTAAAATGTCTGATCAGGG - Intergenic
1010405906 6:75505584-75505606 GCAACTAAACAGACTGGTCATGG - Intergenic
1012614598 6:101261265-101261287 GATTTTAAACAGGTTTATCATGG - Intergenic
1013936404 6:115600696-115600718 GAATTTAAGCAGAATGATCAAGG + Intergenic
1016135697 6:140539152-140539174 ACATTTAAAAAGGCAGATGATGG - Intergenic
1020218105 7:6211231-6211253 TCCTTTAGACAGGGTGATCAGGG - Intronic
1020728209 7:11843771-11843793 GCATTTCAACAAGCAGGTCATGG - Intergenic
1022253017 7:28627606-28627628 GCATTTCAAGAGGCAGGTCATGG - Intronic
1023330550 7:39111282-39111304 GCATTTAGGCAGGATTATCATGG + Intronic
1024079344 7:45843359-45843381 GCATTCAAACTGGCCGGTCAAGG - Intergenic
1024231758 7:47368524-47368546 GCAGCTCAACAGGCTGATCCTGG - Exonic
1026459123 7:70597886-70597908 GATTTTCAACAGGATGATCAGGG + Intronic
1027423346 7:78038609-78038631 GCATTTTAACAGGCTCCCCAGGG + Intronic
1028450916 7:90982258-90982280 GCATTTAAACAGGATTATAGTGG + Intronic
1030412114 7:109193601-109193623 CCACCTACACAGGCTGATCATGG + Intergenic
1030648003 7:112085771-112085793 GCATTTGAACTTGCTGATCTAGG + Intronic
1035005250 7:155652918-155652940 GAATATAAACAGGCTGTACAGGG + Intronic
1036198908 8:6749794-6749816 GCATTTAAACAAGGTTATTATGG - Intronic
1038505647 8:28082610-28082632 TCACTTAAACAGCCTGAGCATGG + Intronic
1039221684 8:35338792-35338814 GCATTTAACAAGGCAAATCAGGG - Intronic
1040872681 8:52116971-52116993 GCATTTTAACAGGCTCATCTTGG - Intronic
1042103712 8:65301364-65301386 GCATTTATATAGGATGATTAAGG + Intergenic
1042257663 8:66822146-66822168 ACATATAAACAGGCAGTTCATGG - Intronic
1042657925 8:71120713-71120735 GCATTTAAACATATAGATCAAGG + Intergenic
1048640044 8:136346151-136346173 GAATTTAGACAGGATGTTCAGGG - Intergenic
1050528740 9:6568893-6568915 GCATTTACTCAGGCTGATTAAGG + Intronic
1052350208 9:27450778-27450800 ACATTTAAACAAGCTGAAGAAGG - Intronic
1052606782 9:30714210-30714232 GCATATAATCAGGCTGTTAAGGG + Intergenic
1055247590 9:74265461-74265483 GAATTTTAACAGACTGATTAAGG + Intergenic
1055318873 9:75062739-75062761 ACATTTAAAAAGGCTGAGCATGG + Intronic
1057619302 9:96620338-96620360 GCATTCAAACAGGCCAAGCAAGG + Intergenic
1058771575 9:108238502-108238524 ACATTTAATCAGGCTGATTCTGG - Intergenic
1059757623 9:117308606-117308628 TCATTTTTCCAGGCTGATCAAGG + Intronic
1188874655 X:35415115-35415137 GCAATTAAAAGGGGTGATCAAGG - Intergenic
1191661039 X:63650806-63650828 TCTTTTAATCAGGCTTATCAGGG - Intronic
1197334085 X:125190468-125190490 GGATTTGAACAGGATGTTCAAGG - Intergenic
1198237287 X:134747235-134747257 GCAACTAAACAGGCTGCTCTTGG - Intronic
1199700991 X:150375436-150375458 GCATAGCAACAGGCTGAGCAAGG - Intronic
1199859187 X:151784424-151784446 TGATTTAAACAGCATGATCAAGG - Intergenic