ID: 923459267

View in Genome Browser
Species Human (GRCh38)
Location 1:234194572-234194594
Sequence CCATAGGTTTGAGGGGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 1, 2: 31, 3: 83, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923459267 Original CRISPR CCATAGGTTTGAGGGGGAAC AGG (reversed) Intronic
901322506 1:8348408-8348430 CTACAGGTTTCTGGGGGAACAGG + Intergenic
902274714 1:15331159-15331181 GCCCAGGTTTGAGGGGGAAGAGG + Intronic
902544395 1:17179787-17179809 CCGTAGGTTTTTGGGGGAACAGG + Intergenic
905052956 1:35067922-35067944 CCATAGGTTATCGGGGGTACAGG - Intronic
906816002 1:48879979-48880001 TCATAGGTTATTGGGGGAACAGG + Intronic
906993196 1:50761251-50761273 CCAGAGGTATAAGGAGGAACTGG + Intronic
908614244 1:65900007-65900029 CCATACGTTATTGGGGGAACAGG - Intronic
909427638 1:75545688-75545710 CTAAAGGTTTGAAGAGGAACAGG - Intronic
910404197 1:86869086-86869108 CTAAAGGTTAGAGAGGGAACAGG + Intronic
910899141 1:92100939-92100961 CCATAGGTTTGTGGGGGAACAGG + Intronic
912741444 1:112201725-112201747 CCAGAGGTACAAGGGGGAACTGG - Intergenic
915302526 1:154959576-154959598 CCATAGGATTGGGAGGGAAGGGG + Exonic
916026190 1:160835676-160835698 CCATAGGTTTTTTTGGGAACAGG - Intronic
916457903 1:164990029-164990051 CAATAGGTTTTTGGGGGAGCAGG + Intergenic
916598306 1:166267854-166267876 CCAGAGGTTCAAGGAGGAACTGG + Intergenic
917771846 1:178287957-178287979 CAATAGGTTTTTGGGGGAATGGG - Intronic
917990928 1:180377985-180378007 CCATAAGTTTGAGGAGAAACAGG + Intronic
919398144 1:197076078-197076100 CCATAGGCTATTGGGGGAACAGG - Intergenic
919494848 1:198251454-198251476 CCAGAGGTATAAGGAGGAACTGG - Intronic
920110236 1:203582448-203582470 CCCTAGGGAAGAGGGGGAACAGG + Intergenic
920504922 1:206508671-206508693 CCAAAGGTTTGAGGGGCCAGAGG - Intronic
923000892 1:230005546-230005568 CCATAGGTTTTTGGGGGAACAGG + Intergenic
923459267 1:234194572-234194594 CCATAGGTTTGAGGGGGAACAGG - Intronic
1065406313 10:25369746-25369768 CCAGAGGTATAAGGAGGAACTGG - Intronic
1066202875 10:33159004-33159026 CTATTGGTTTTGGGGGGAACAGG - Intergenic
1066706318 10:38182910-38182932 CCATAGGGTTTGGGGGAAACAGG + Intergenic
1066784411 10:38987307-38987329 CCATAGGTTTTTTGGGGAACAGG + Intergenic
1066983637 10:42443151-42443173 CCATAGGTTTTGGGGGAAACAGG - Intergenic
1067212510 10:44271868-44271890 CCAGAGGTATGAGGAGGAACTGG + Intergenic
1067322489 10:45235272-45235294 CAATAGGTTTCAGTGGGAACTGG + Intergenic
1067371488 10:45687731-45687753 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1067388295 10:45838419-45838441 CCATAGGTTTCTGGGGGAACAGG - Intronic
1067417830 10:46118864-46118886 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1067445971 10:46346155-46346177 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1067503186 10:46825426-46825448 CCTTAGGTTTCTGGGGGAACAGG + Intergenic
1067591411 10:47514590-47514612 CCATAGGTTTCTGGGGGAACAGG - Intronic
1067638529 10:48022685-48022707 CCATAGGTTTCTGGGGGAACAGG - Intergenic
1067874960 10:49997647-49997669 CCATAGGTTTCTGGGGGAACAGG + Intronic
1068098893 10:52527376-52527398 CAATAGGTTTTTAGGGGAACAGG + Intergenic
1068188267 10:53615553-53615575 CCATAGGTTTCAGGAGGAGAAGG - Intergenic
1068534261 10:58223124-58223146 CAATAGGTTTTTGGGGGAATAGG - Intronic
1069355608 10:67581637-67581659 CCAGAGGTATGAGGAGGAGCTGG - Intronic
1069360787 10:67639419-67639441 CCAGAGGTATGAGGAGGAGCTGG + Intronic
1070135128 10:73687102-73687124 CCATAGGTTTCTGGGGGAACAGG - Intronic
1071488336 10:86118459-86118481 CAATAGGTTCTTGGGGGAACAGG - Intronic
1074383246 10:112997047-112997069 TCATTAGTTTGTGGGGGAACAGG - Intronic
1075198341 10:120380180-120380202 CCCTCGGTTTGAGGGGCAAGAGG + Intergenic
1075445911 10:122512715-122512737 TCATAGGTTTTTGGGGGAACAGG + Intronic
1077240617 11:1508569-1508591 CCATAGGCCTGCGGGAGAACGGG + Intergenic
1077887258 11:6395270-6395292 CCATGTGTTTCAGGTGGAACAGG - Exonic
1078069078 11:8096565-8096587 GCATAAGTTTGTGGGGGTACAGG + Intronic
1078470014 11:11579096-11579118 ACATAGGTTTGGCTGGGAACTGG + Intronic
1080202877 11:29693840-29693862 CAATAGGTTTTTGGGGAAACAGG + Intergenic
1081192475 11:40120503-40120525 ACATAGGTTTCAGGGGGAGAGGG + Intronic
1081511509 11:43778398-43778420 CCAGAGGTATAAGGAGGAACTGG + Intronic
1082112825 11:48295983-48296005 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1082155150 11:48801025-48801047 CCAGAGGTATGAGGAGGAGCTGG - Intergenic
1082772438 11:57218753-57218775 TAATAGGTTTTTGGGGGAACAGG - Intergenic
1085364784 11:75929682-75929704 CCATAGATTTGTGGGGGACAGGG + Intronic
1087722338 11:101680992-101681014 CCAGAGGTATAAGGAGGAACTGG - Intronic
1088605987 11:111532592-111532614 CTATAGGTTTCAGAGGGAGCAGG + Intronic
1089416447 11:118296169-118296191 CCAGTGGGTTCAGGGGGAACTGG - Intergenic
1089569230 11:119392005-119392027 CCATAGGTTTTTAGGGGAACAGG + Intergenic
1092506024 12:9101031-9101053 CCATAGGTTTTTGGGGGAACAGG - Intronic
1093434619 12:19122316-19122338 CCAGAGGTCTGAGTGGGAAGTGG + Intergenic
1093549717 12:20393424-20393446 CCATAGTTCTGGGAGGGAACTGG - Intronic
1095151983 12:38806166-38806188 CCAGAGGCATGAGGAGGAACTGG + Intronic
1096051331 12:48611555-48611577 CCAGAGGTTTGAAGAGGAGCTGG - Intergenic
1096433152 12:51565211-51565233 CCAGAGGTACGAGGAGGAACTGG - Intergenic
1096917175 12:55045831-55045853 CCATGGGTTTTGGGGAGAACAGG + Intergenic
1096959491 12:55563900-55563922 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1097568199 12:61297318-61297340 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1097765147 12:63517966-63517988 CCATAGGTTCCTGGGGGAACAGG - Intergenic
1098603597 12:72363185-72363207 CCAGAGGTACGAGGAGGAACTGG + Intronic
1098689640 12:73470814-73470836 CCATAGGTTTTGGGGCCAACAGG - Intergenic
1099130345 12:78821347-78821369 CCATATGCCTGAGGTGGAACAGG + Intergenic
1100722048 12:97369474-97369496 CCATAGATTATTGGGGGAACAGG - Intergenic
1102245560 12:111353614-111353636 CCATAGGCAGGAGGTGGAACTGG + Intergenic
1102434858 12:112913960-112913982 CAATAGGTTTTTGGGGGAACAGG + Intronic
1102831568 12:116006604-116006626 CCATAGGATTGAGGGGAAAGTGG - Intronic
1102994301 12:117336614-117336636 CAATAGGTTTTTTGGGGAACAGG - Intronic
1104554698 12:129789079-129789101 CAATAGTTTTCAGGGTGAACAGG + Intronic
1107668671 13:42719541-42719563 TCATAGGTTTGATGGGGCACTGG - Intergenic
1107787908 13:43972764-43972786 CCAGAGGTATGAGGAGGAACTGG - Intergenic
1108437080 13:50411221-50411243 CAATAGGTTGGAGTGGGAGCAGG + Intronic
1108587221 13:51880920-51880942 CCATAGGTTTTTGGGGGAACAGG - Intergenic
1109270304 13:60248476-60248498 CCAGAGGTATAAGGAGGAACGGG - Intergenic
1109980571 13:69900915-69900937 CTACAAATTTGAGGGGGAACAGG - Intronic
1110036992 13:70700026-70700048 CCATTGTTTTAAGGGGGGACTGG + Intergenic
1110137323 13:72084224-72084246 CCATAGGTATGAAGAGGAGCTGG + Intergenic
1110173654 13:72531799-72531821 CCATAGGTTTTTGAGGGAACAGG - Intergenic
1110811824 13:79819633-79819655 CCAGAGGTATGAGGAGGAACTGG - Intergenic
1110814177 13:79843219-79843241 CCAGAGGTATGAGGAGGAACTGG + Intergenic
1110841994 13:80153821-80153843 CCAGAGGTACGAGGAGGAACTGG + Intergenic
1111162242 13:84410315-84410337 TCATAGGTTTTGGGGGGAACAGG - Intergenic
1111492570 13:89001659-89001681 CCATAGTTTTTTGGGGGAACAGG + Intergenic
1111690446 13:91556946-91556968 CCACAGGTTTTGGGGGGAACAGG - Intronic
1111727611 13:92032412-92032434 CCATAGGTTTGGGGGGAAACGGG - Intronic
1112460704 13:99601438-99601460 CCATGGGTGTATGGGGGAACGGG - Intergenic
1114504915 14:23202993-23203015 CCATAGGTTTTTTGGGGAACAGG + Intronic
1114751196 14:25206806-25206828 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1114801563 14:25781442-25781464 CCAGAGGTACAAGGGGGAACTGG - Intergenic
1115561081 14:34583475-34583497 CCATAGGTTTGTGCCAGAACGGG - Intronic
1115656998 14:35452867-35452889 CAATAGTTTTTTGGGGGAACAGG + Intergenic
1116711042 14:48368832-48368854 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1117883998 14:60340570-60340592 CCAGAGGTATGAGGAGGAGCTGG + Intergenic
1118129657 14:62948572-62948594 CCAGAGGTATAAGGAGGAACTGG + Intronic
1118531442 14:66711060-66711082 CCATAGGTTATTGGGGGTACAGG + Intronic
1119006793 14:70938707-70938729 CCAGAGGTATAAGGAGGAACTGG - Intronic
1119582179 14:75795439-75795461 CAGTAGGTTTTTGGGGGAACAGG + Intronic
1119995038 14:79244259-79244281 GCATAGGATTGAGGAGGATCAGG - Intronic
1120450466 14:84660192-84660214 CAATAGGCTTTTGGGGGAACAGG + Intergenic
1120958248 14:90101859-90101881 CCATAGGTTTTCGGGGGAACAGG - Intronic
1123067305 14:105625172-105625194 CCTTGGGTTTTGGGGGGAACAGG + Intergenic
1124211643 15:27769619-27769641 CAATAGGTTTTAGGGGGAACAGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1124653528 15:31489500-31489522 CCCCAGGATTTAGGGGGAACAGG + Intronic
1126272134 15:46832341-46832363 CCAGAGGTACGAGGAGGAACTGG + Intergenic
1127041191 15:54978723-54978745 CCATAGGTTTTTGGGAGAACAGG - Intergenic
1127195185 15:56576590-56576612 CCATAGGTTATTGGTGGAACAGG - Intergenic
1127505258 15:59591821-59591843 CCATTGGATTGTTGGGGAACAGG + Intergenic
1129175781 15:73838911-73838933 CCATGGGTTTCAGGGTGACCTGG - Intergenic
1129707156 15:77801057-77801079 CCATTGGATGGAGGGGGAATTGG + Intronic
1131924243 15:97364414-97364436 CCAGAGGTTCAAGGAGGAACTGG + Intergenic
1131925191 15:97375064-97375086 CCAGAGGTTCAAGGAGGAACTGG - Intergenic
1132147191 15:99436055-99436077 ACAGAGGTTTGAGAGGGAGCTGG + Intergenic
1132360908 15:101214597-101214619 CCCTATGTTGGAGGGGGACCTGG + Intronic
1132975695 16:2710123-2710145 CCCAAGGTCTGAGGAGGAACAGG - Intergenic
1133595006 16:7282598-7282620 CCATAGGTTATTGGGGGAACAGG + Intronic
1133608018 16:7407078-7407100 TCATAGGTTTTTGGGGGAACGGG + Intronic
1133836019 16:9368003-9368025 CAGTAGGTTTTTGGGGGAACAGG + Intergenic
1135274833 16:21103287-21103309 CCATAGGTTTTTGGGGGAACAGG - Intronic
1135657103 16:24259932-24259954 CCATAGGTCTGAGGTAGACCAGG + Intronic
1135704143 16:24660092-24660114 CTGTAGGTTTTGGGGGGAACAGG + Intergenic
1136573709 16:31111154-31111176 GCATAGGGATGAAGGGGAACCGG - Exonic
1136647271 16:31632444-31632466 CCAGAGGTACAAGGGGGAACTGG - Intergenic
1137083450 16:36094500-36094522 CCAGAGGTACGAGGAGGAACTGG - Intergenic
1137221089 16:46451990-46452012 CCAGAGGTACAAGGGGGAACTGG - Intergenic
1137494236 16:48957341-48957363 CCATAGGTTTTTGGGGAAACAGG - Intergenic
1137639773 16:50018468-50018490 CAATAGGTTTTTGGGGGAACGGG - Intergenic
1139942428 16:70615098-70615120 CCAGAGATTTGGGGGGTAACAGG - Intronic
1140357752 16:74320631-74320653 CCAAAGGTTTGGGGGTGAAATGG + Intergenic
1140547419 16:75824537-75824559 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1148762359 17:50013209-50013231 ACCTTGTTTTGAGGGGGAACTGG - Intergenic
1148966074 17:51437279-51437301 CCATAGGTTATTGGGGGAACGGG + Intergenic
1149399773 17:56283866-56283888 CCATAGGTTTTTGGGGGAACTGG - Intronic
1150469939 17:65428664-65428686 CTATAGGTTTTTGGGGGAACAGG - Intergenic
1150911486 17:69392253-69392275 CAATAAGTTTTTGGGGGAACAGG + Intergenic
1151281873 17:73082089-73082111 CAGTAGGTTTTGGGGGGAACAGG - Intronic
1153040421 18:807989-808011 CCCTAGATTTGGGGGGGAAAAGG + Intronic
1153095108 18:1392111-1392133 CCATAGGTCTGAAGGGGCAAGGG + Intergenic
1154062164 18:11072093-11072115 ACATAGGCTTGAGGGGTACCAGG - Intronic
1154341594 18:13507183-13507205 CAATAGGTTTTTTGGGGAACAGG + Intronic
1154478416 18:14790969-14790991 CCAGAGGTATAAGGAGGAACTGG - Intronic
1155641337 18:28019269-28019291 CAATAGGTTTTTGGGGGAACAGG - Intronic
1156092228 18:33486005-33486027 CCATTGGTTTGAAGGGGAAAGGG + Intergenic
1157144463 18:45147627-45147649 CAATGGGTTTTTGGGGGAACAGG + Intergenic
1157260001 18:46169338-46169360 CTAGAGGTTTGTGGGGGAAAGGG + Intergenic
1157810095 18:50688863-50688885 CCATAGGTTTTTGGGAGAACAGG - Intronic
1157925945 18:51766371-51766393 CCAGTGGTTTCATGGGGAACTGG - Intergenic
1158673428 18:59497684-59497706 CCACTGGTTTGAGGGGTACCTGG - Intronic
1158834182 18:61313155-61313177 CCAGAGGTACAAGGGGGAACTGG - Intergenic
1158910067 18:62051279-62051301 CCAGAGGTTTAAGGAAGAACTGG - Intronic
1159660964 18:71095406-71095428 CCAGAGGTACGAGGAGGAACTGG - Intergenic
1159907071 18:74103080-74103102 CCACAGGTTTTTGGGGGAACAGG - Intronic
1161047328 19:2142711-2142733 CCATTGGGGTGAGGGGGACCGGG - Intronic
1164636349 19:29794298-29794320 CCATAGGTTTTTGGGGGAATAGG - Intergenic
1164889495 19:31811120-31811142 CCATAAGTTTTTGGGGGAACAGG + Intergenic
1164928132 19:32147209-32147231 CAATAGGTTTTTGGGGGAACAGG + Intergenic
1165165950 19:33856515-33856537 CAATAGGTTTTGTGGGGAACAGG - Intergenic
1165660372 19:37573951-37573973 ACCTAGGTTTGAGGTGGAAAAGG - Intronic
1165988280 19:39789844-39789866 CAGTAGGTTTTTGGGGGAACAGG - Intergenic
1166264004 19:41665723-41665745 CCATAAGTTTTTGGGGGAACAGG - Intronic
1166306914 19:41940434-41940456 CCAAAGGTTTGAAGCGGAAATGG - Intergenic
1166511205 19:43410144-43410166 CTGTTGGTTTGAGAGGGAACTGG + Intronic
925374422 2:3372793-3372815 CCAGAGGTATAAGGAGGAACTGG + Intronic
925417832 2:3684433-3684455 CAACAGGTTTTTGGGGGAACAGG + Intronic
925532666 2:4882252-4882274 CCATAGGTTTTGGGGGGAACTGG - Intergenic
925961737 2:9023513-9023535 CAATAGGTTTTTTGGGGAACAGG - Intergenic
926772560 2:16391413-16391435 CCATAGGTTTTTGGGGGAACAGG + Intergenic
927036208 2:19179413-19179435 CAATAGGTTTTTGGGGTAACCGG + Intergenic
927049119 2:19309267-19309289 CCAGAGGTATAAGGAGGAACTGG + Intergenic
928802297 2:35109429-35109451 CCAGAGGTATAAGGAGGAACTGG - Intergenic
929300800 2:40301758-40301780 CCATAGGTTTTGGGGAAAACAGG + Intronic
930962984 2:57283891-57283913 CCAGAGGTATAAGGAGGAACTGG + Intergenic
931210777 2:60192449-60192471 CCAGAGGTTCAAGGAGGAACTGG + Intergenic
931554203 2:63481867-63481889 CCATAGGTTTTTGGGGGAACAGG - Intronic
932635492 2:73384828-73384850 CCATAGGTTATTGGGGGTACAGG + Intergenic
932985864 2:76725416-76725438 CCAGAGGTATAAGGAGGAACTGG - Intergenic
934318632 2:91950197-91950219 CCAGAGGTATAAGGAGGAACTGG - Intergenic
935146466 2:100398866-100398888 GCATGGGTTGGAGGGGGCACAGG + Intronic
935180744 2:100689167-100689189 CCATAGGTTTTGGGGGGAACGGG - Intergenic
939496029 2:142929626-142929648 CCATAGGTTTGGGGGAGAGGAGG + Intronic
939682669 2:145158001-145158023 CCATAAATTTGAGGGGGCTCAGG - Intergenic
939721905 2:145664016-145664038 CCATAGGTTCAAGGGGCAAGTGG - Intergenic
940056647 2:149520228-149520250 CCATAGGTTATTGGGGGCACAGG - Intergenic
940423167 2:153502103-153502125 TAATAGGTTTTTGGGGGAACAGG + Intergenic
940802763 2:158151514-158151536 CCATAGGTTATTGGGGGAACAGG - Intergenic
940812987 2:158266485-158266507 CCATAGTTTTTTGGGGAAACAGG + Intronic
941450591 2:165655677-165655699 CCAAAGGTTTCAGAGGGAGCCGG - Intronic
944072686 2:195690868-195690890 CAATAGGTTTTTTGGGGAACAGG + Intronic
945579983 2:211581244-211581266 CCATAGGTTATTGGGGGAACAGG - Intronic
946462673 2:219883174-219883196 CCATAGGTTTTTTGGGGAACAGG + Intergenic
947263022 2:228245856-228245878 CCATAGGTCTGAGGAGGAGGTGG - Intergenic
947996200 2:234529787-234529809 CCACAGGTGAGAGGGGGAACTGG + Intergenic
948821178 2:240547926-240547948 CCAGAGGTACAAGGGGGAACTGG + Intronic
1169022331 20:2339606-2339628 CCTCAGCTTTGAGGGGGAAGGGG - Intronic
1169188006 20:3635337-3635359 CAATAGGTTTTTGGGGGAACAGG - Intronic
1169244772 20:4016550-4016572 CCATTGGTTTGATGGGGAGATGG + Intergenic
1170035792 20:11988237-11988259 CAATAGGACTGAGAGGGAACTGG + Intergenic
1170292015 20:14781197-14781219 CCAGAGGTTTGAGGTGGGGCGGG - Intronic
1170483037 20:16787255-16787277 CAATAGGTTTTTTGGGGAACAGG + Intergenic
1170832537 20:19855459-19855481 CCAGAGGTATGAGGAGGAGCTGG - Intergenic
1175813454 20:61871532-61871554 CCCTAGGAGTGAGGGTGAACTGG - Intronic
1176337878 21:5615824-5615846 GGATAGGTTTCAGGGGGAAGAGG - Intergenic
1176339286 21:5678897-5678919 GGATAGGTTTCAGGGGGAAGAGG - Intergenic
1176471540 21:7111050-7111072 GGATAGGTTTCAGGGGGAAGAGG - Intergenic
1176495101 21:7492828-7492850 GGATAGGTTTCAGGGGGAAGAGG - Intergenic
1176505541 21:7645559-7645581 GGATAGGTTTCAGGGGGAAGAGG + Intergenic
1176886071 21:14257007-14257029 CTATAGGTTTTTGGGGGAACAGG + Intergenic
1177123425 21:17166442-17166464 CCATAGGTACAAGGAGGAACTGG + Intergenic
1178580147 21:33831495-33831517 ACGTAAGTTTGAGGGGGAAGAGG + Intronic
1183057264 22:35314614-35314636 CCATCGTTTTCAGGGGGTACTGG + Intronic
1183154058 22:36060774-36060796 CCATAGGTTTTGGAGGGAACAGG - Intergenic
1183529978 22:38348107-38348129 CCAGGGGTGTGAGGGGGGACAGG - Intronic
1184047221 22:41978935-41978957 CCAGGGGTTGGAGGGGGAACAGG + Intronic
949666428 3:6344360-6344382 CCAGAGGTATAAGGAGGAACTGG + Intergenic
949799691 3:7890092-7890114 CAATAGATTTTGGGGGGAACAGG - Intergenic
950757702 3:15190094-15190116 CCAGAGGTTCAAGGAGGAACTGG + Intergenic
950919535 3:16680151-16680173 CCAGAGGTATAAGGAGGAACTGG + Intergenic
951487405 3:23229306-23229328 CCATAGGTTTTTTGGGGAACAGG + Intronic
952373974 3:32749862-32749884 CCATAGGTATGTGGGGGAACAGG - Intronic
953484601 3:43283570-43283592 CAGTAGGTCTGAGGTGGAACTGG + Intergenic
953544430 3:43853942-43853964 CCATAGATCTGAGGGCAAACAGG - Intergenic
954423960 3:50433733-50433755 CTATAGTTCTGAGGGGTAACAGG - Intronic
954990870 3:54839707-54839729 CCACAGCTGTGAGGGGGACCTGG + Intronic
955135771 3:56216556-56216578 CCAGAGGTATAAGGAGGAACTGG + Intronic
956243038 3:67151200-67151222 CCAGAGGTAGAAGGGGGAACTGG + Intergenic
957025229 3:75173916-75173938 CAATAGTTTTTGGGGGGAACAGG + Intergenic
957312503 3:78539130-78539152 CTATAGGTTTTTGGGGGAACAGG - Intergenic
957395046 3:79625771-79625793 CCAGAGGTACAAGGGGGAACTGG + Intronic
958011544 3:87885903-87885925 CCAGAGGTATAAAGGGGAACTGG + Intergenic
958012184 3:87894027-87894049 CCATAGGTTTTGGGGGGAACAGG + Intergenic
958014315 3:87920377-87920399 CCATAGGTTATTGGGGGAACAGG - Intergenic
958152631 3:89710116-89710138 CAATAGTTTTGTGGGGGTACAGG - Intergenic
958548457 3:95587939-95587961 CCATAGGGTGGAAGGGGACCCGG + Intergenic
958661355 3:97071739-97071761 CCATAGGTTTTGAGGGGAACAGG + Intronic
958861378 3:99448921-99448943 CGATAGTTTTTTGGGGGAACAGG + Intergenic
959561441 3:107787677-107787699 CAATAGGTTTGTGAGGGAACGGG + Intronic
960064458 3:113355196-113355218 CAATAGGTTTTTGGGGGAACAGG - Intronic
961632113 3:128308717-128308739 CCATAGGTGTGAGGAGGGGCAGG - Intronic
962174633 3:133139964-133139986 CCTAAGGTGTGAGGGGGAAGAGG + Intronic
963955140 3:151245182-151245204 CCAGAGGTATAAGGAGGAACTGG + Intronic
963958856 3:151285659-151285681 CAATAGGTTTTTGGGGGAACAGG - Intronic
963996246 3:151712400-151712422 CAACAGATTTGGGGGGGAACAGG - Intergenic
965228604 3:166023678-166023700 CCAGAGGTATAAGGAGGAACTGG - Intergenic
965378167 3:167953296-167953318 CCATAGGTTTTTTGGGGAACAGG + Intergenic
965718037 3:171628424-171628446 CCAGAGGTATAAGGAGGAACTGG + Intronic
966128351 3:176606856-176606878 CCATAAGTTTGAAGTGGAATGGG - Intergenic
967664209 3:192151895-192151917 CCAGAGGTACGAGGAGGAACTGG - Intronic
969835416 4:9836276-9836298 CCATAGGTTTTTTGGGGAACAGG - Intronic
970040929 4:11796130-11796152 CCAGAGGTATAAGGAGGAACTGG + Intergenic
970120932 4:12751691-12751713 CCAGAGGTACGAGGAGGAACAGG + Intergenic
970684370 4:18549494-18549516 CCAGAGGTACGAGGAGGAACTGG - Intergenic
973782383 4:54300617-54300639 CCTTCGGTTTGTGGGGGAGCTGG + Intergenic
974829807 4:67176112-67176134 CCAGAGGTATGAGGAGGAGCTGG - Intergenic
975493543 4:75014014-75014036 CCAGAAGTTAGAGGGGGAAATGG + Intronic
975535071 4:75441557-75441579 CAATAGGTTTTTGGGGGAACAGG - Intergenic
976086915 4:81416199-81416221 CAATAGGTTTTGGGGGAAACAGG - Intergenic
976791836 4:88887262-88887284 CAATAGGTTTTTGGGGGAACAGG - Intronic
977485333 4:97636905-97636927 CCAGAGGTATAAGGAGGAACCGG + Intronic
978058488 4:104305649-104305671 TAATAGGTTTTGGGGGGAACAGG + Intergenic
978064266 4:104377095-104377117 CCAGAGGTATTAGGAGGAACTGG + Intergenic
978250602 4:106627405-106627427 CAATAGGTTTTTGGGGCAACAGG + Intergenic
978456242 4:108895736-108895758 CAATGGGTTTTTGGGGGAACAGG + Intronic
978864478 4:113491719-113491741 CCAGAGGTACGAGGAGGAACTGG - Intronic
978923973 4:114220040-114220062 CCATAGGTTATTGGGGGAACAGG + Intergenic
979483127 4:121240887-121240909 CCATAGGTTTTAGGGGAACAGGG + Intergenic
980026037 4:127767887-127767909 CAATAGGTTTTTTGGGGAACAGG - Intronic
980431421 4:132703287-132703309 CAATAGGTTTTTGGGGGAACAGG - Intergenic
981607488 4:146555513-146555535 CCAGAGGTATAAGGAGGAACTGG - Intergenic
982631136 4:157830805-157830827 CCATAGGTTATTGGGGGTACTGG - Intergenic
982650912 4:158086820-158086842 CCAGAGGTATAAGGAGGAACTGG - Intergenic
983350560 4:166582471-166582493 CCATAGGTTTTTGGGGGAACAGG + Intergenic
984462592 4:180057336-180057358 CCAGAGGTCAGACGGGGAACAGG - Intergenic
987753033 5:22066176-22066198 CCATAGGTTTTTGGGGGAACAGG + Intronic
987832610 5:23115516-23115538 TCACAGGTTTTGGGGGGAACAGG - Intergenic
988929131 5:36018788-36018810 CAATAGGTTTATGGAGGAACAGG + Intergenic
989246744 5:39263763-39263785 CCACACTTTTGAGGGAGAACAGG + Intronic
989849983 5:46196842-46196864 CCAGAGGTATAAGGAGGAACTGG + Intergenic
990105173 5:52249297-52249319 CCAGAGGTATAAGGAGGAACTGG - Intergenic
990918190 5:60933592-60933614 CAATAGGTTTTGGGGGGAACAGG + Intronic
991419216 5:66424302-66424324 CAATAAGTTTTTGGGGGAACAGG + Intergenic
991541916 5:67739481-67739503 CCACAGGTACAAGGGGGAACTGG - Intergenic
992086533 5:73282985-73283007 CCCTAGGGTTGTGGGGGAACTGG - Intergenic
992339559 5:75808640-75808662 CCATAGGTTATTGGGGGAACAGG + Intergenic
992899169 5:81276180-81276202 CAGTAGGTTTTTGGGGGAACAGG - Intergenic
994574162 5:101555118-101555140 CCAGAGGTACGAGGAGGAACGGG + Intergenic
994693868 5:103050167-103050189 CCAGAGGTATAAGGAGGAACTGG + Intergenic
995814474 5:116151437-116151459 CCAGAGGTACGAGGAGGAACTGG - Intronic
995895200 5:117003328-117003350 TAATAGGTTTTGGGGGGAACAGG + Intergenic
996128812 5:119755997-119756019 CCATAGGATTTTGGGGGAACAGG - Intergenic
996831911 5:127749691-127749713 CCATAGGTAAAAGGAGGAACTGG - Intergenic
996930618 5:128882277-128882299 CAATAGATTTTTGGGGGAACAGG + Intronic
997005976 5:129817046-129817068 CCAGAGGTATAAGGAGGAACTGG + Intergenic
997780169 5:136649596-136649618 CAATAGGTTTTTGGGGGAACAGG + Intergenic
998724649 5:144996568-144996590 CCAGAGGTACGAGGAGGAACTGG + Intergenic
999912980 5:156226081-156226103 CCATAGGTTACTGGGGGGACAGG + Intronic
1001176646 5:169475274-169475296 CCATAGGTTTGGTGAGGAACAGG + Intergenic
1001539596 5:172528130-172528152 GCATGGGCTTGAGGGGGGACAGG - Intergenic
1003252236 6:4440159-4440181 CCACAGTTTTTTGGGGGAACAGG + Intergenic
1004389895 6:15201332-15201354 CCACTGGCTTGTGGGGGAACAGG + Intergenic
1004592610 6:17068444-17068466 CCCTAGGTTTTTGGGGGAACAGG + Intergenic
1004858650 6:19778039-19778061 CCATAGGTTTTTGGGGGAACAGG + Intergenic
1004881707 6:20014830-20014852 CTTTAGGTTTGTGGGGGGACAGG - Intergenic
1005930368 6:30479541-30479563 CAATAGGTTTTTGGGAGAACAGG - Intergenic
1007063207 6:38963101-38963123 CAACAGGTTTTGGGGGGAACAGG - Intronic
1007368724 6:41412605-41412627 CCACAGGTTCCAGGGGGAGCTGG - Intergenic
1007927123 6:45659023-45659045 CCATATGTATGAGGGGGATGGGG + Intronic
1008350216 6:50481057-50481079 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1008354021 6:50530132-50530154 CAATAGGTTTTTTGGGGAACAGG - Intergenic
1008406594 6:51124989-51125011 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1008431133 6:51418714-51418736 CAATAGGTTTTTGGAGGAACAGG + Intergenic
1009445492 6:63737666-63737688 CCAGAGGTATAAGGAGGAACTGG - Intronic
1009499511 6:64393194-64393216 CCATAGGTACAAGGAGGAACTGG + Intronic
1009744639 6:67797178-67797200 CCATAGGTTTTTGGTGGAACAGG - Intergenic
1010045897 6:71442812-71442834 CCATAGGTTATTGGGGGAATAGG - Intergenic
1010293128 6:74163131-74163153 CCATAGGTTGTTGGGGGTACAGG - Intergenic
1010983103 6:82391994-82392016 TCAGAGGTATGAGGAGGAACTGG - Intergenic
1011290300 6:85770056-85770078 TCATAGGTTTTGGGGGGAATGGG + Intergenic
1011387015 6:86809242-86809264 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1011390320 6:86845093-86845115 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1012060770 6:94477058-94477080 CCATAGGTTATTGGGGGAACAGG - Intergenic
1012183212 6:96181454-96181476 TCATAGGTTATTGGGGGAACAGG + Intronic
1012656139 6:101823812-101823834 CTATGGGTTTTCGGGGGAACAGG + Intronic
1014092773 6:117423284-117423306 CCATAAGTTATTGGGGGAACAGG - Intronic
1014704496 6:124729121-124729143 CCAGAAGTATGAGGAGGAACTGG + Intronic
1014957730 6:127641868-127641890 CCAACGGTTTGAGGAGGGACGGG - Intergenic
1016474373 6:144410431-144410453 CCATAGGTTTTGGGGGGAACAGG + Intronic
1016499650 6:144705126-144705148 CCATGGGTTTTAGGGTGCACTGG + Intronic
1017295297 6:152786551-152786573 CAATAGGTTTTGGGGGTAACAGG + Intergenic
1017302373 6:152876794-152876816 CCATAGGTTTTGGGGGGAACAGG - Intergenic
1017374425 6:153751545-153751567 CAATAGGTTTTTGAGGGAACAGG + Intergenic
1017905523 6:158755361-158755383 CCATAGACTTGAGGGAAAACTGG + Intronic
1018582949 6:165323707-165323729 CCATGGGTTTGAGGTCCAACGGG - Intergenic
1018780539 6:167059892-167059914 CCAGAGGTTGGAGGGGGAGGTGG + Intergenic
1019455194 7:1123204-1123226 CCACAGGCCTGAGTGGGAACCGG + Intronic
1019788027 7:2991787-2991809 CCATAGGTTTTTGGGGGTACAGG + Intronic
1021354311 7:19635172-19635194 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1021620241 7:22544017-22544039 CAATAGGTTTTTGGGGGAACAGG - Intronic
1022264162 7:28737002-28737024 CCACAGGTCTGGGTGGGAACAGG - Intronic
1022308045 7:29168659-29168681 GCTGAGGTTTGAGGGGGAAGAGG - Intronic
1022953372 7:35359889-35359911 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1024351371 7:48368323-48368345 CCATAGGTTTTTTGGGGAACAGG + Intronic
1026890352 7:73978275-73978297 CCACAGGCTTGAAGGGGAAAGGG - Intergenic
1027897675 7:84065833-84065855 CCAGAGGTACGAGGAGGAACTGG + Intronic
1027983288 7:85253281-85253303 CCAGAGGTTCAAGGAGGAACTGG + Intergenic
1028036459 7:85990159-85990181 CCATAGGTACAAGGAGGAACTGG - Intergenic
1028307217 7:89280818-89280840 CCAGAGGTATAAGGAGGAACTGG + Intronic
1028636967 7:92999950-92999972 CCATAGATGTGTGGGGGAAGAGG + Intergenic
1028726922 7:94098266-94098288 CCATACGTTTTGGGAGGAACAGG - Intergenic
1029998500 7:105032992-105033014 CCATAGGTGAGAGGGTGTACAGG + Intronic
1030625344 7:111839842-111839864 CCATAGGTTTTTGGGGAAACAGG + Intronic
1033301251 7:140188134-140188156 CCATATGTTTGAGGAAGAATAGG + Intergenic
1033999345 7:147392373-147392395 CCATAGGTTTTTGGGGGAACAGG + Intronic
1034208146 7:149336599-149336621 CAATAGGTTTGGGGGGGAACAGG - Intergenic
1034229643 7:149511997-149512019 CAATAGGTTTTGGGGGGAATAGG + Intergenic
1035293936 7:157857274-157857296 CCATAGGCTTGAGGGAAAACAGG - Intronic
1036133897 8:6141123-6141145 CCATAGGTTTTTTTGGGAACAGG - Intergenic
1036937706 8:13019875-13019897 CCAGAGGTGTGAGGGTGAAATGG - Intronic
1037549744 8:19958588-19958610 CCATAGGTTATTGGGGGAACAGG + Intronic
1037671564 8:21019716-21019738 CCACAGCTTTGAAGGGTAACAGG + Intergenic
1037989702 8:23312212-23312234 CCAGAGGTATAAGGAGGAACTGG + Intronic
1039000729 8:32977101-32977123 CAATAGGTTTTTGGGGGAACAGG + Intergenic
1040273337 8:45982612-45982634 CCAGAGGTTCAAGGAGGAACTGG - Intergenic
1041212546 8:55567331-55567353 CAATAGGTTTTTTGGGGAACAGG - Intergenic
1041884254 8:62789875-62789897 CCAGAGGTATAAGGAGGAACTGG + Intronic
1041885176 8:62800176-62800198 CAATAGGTTTTTTGGGGAACGGG - Intronic
1041957020 8:63567314-63567336 CCATAGGGTTGTGTGGGCACAGG + Intergenic
1042644374 8:70969766-70969788 CAATAGGTTTTTGAGGGAACAGG + Intergenic
1043278805 8:78436954-78436976 CCATAGGTTTTTGGGGAAACAGG - Intergenic
1043625127 8:82247453-82247475 ACATAGGTTTTTGGGGGAGCAGG + Intergenic
1043866160 8:85378110-85378132 CCACAGGCTGGAGGGGGAATGGG + Exonic
1044178182 8:89156156-89156178 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1044183301 8:89221786-89221808 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1044601127 8:94006207-94006229 CCAGAGGTACAAGGGGGAACTGG - Intergenic
1044840557 8:96333364-96333386 CCCTAGGCTTGCCGGGGAACAGG - Intronic
1045604189 8:103753515-103753537 CCAGAGGTATAAGGAGGAACTGG - Intronic
1046812923 8:118552090-118552112 CCAGAGGTACGAGGAGGAACTGG + Intronic
1046894522 8:119458776-119458798 CCAGAGGTACGAGGAGGAACTGG - Intergenic
1047409561 8:124613218-124613240 CCATTGGTTGGAGGGAGAGCTGG - Intronic
1049340280 8:142108777-142108799 GGAGAGGATTGAGGGGGAACAGG - Intergenic
1049910610 9:263407-263429 CAAAAGGTTTGAGGGGTAAACGG - Intronic
1052078450 9:24174172-24174194 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1052091712 9:24336895-24336917 CCATAGGTTATTGGGGGTACAGG + Intergenic
1052627933 9:31001543-31001565 CCAGAGGTATGAGGAGGAGCTGG - Intergenic
1052673916 9:31594478-31594500 CCAGAGGTTTGAGGCTGAAGCGG + Intergenic
1055302857 9:74900294-74900316 CCATAGGCTTTTTGGGGAACAGG + Intergenic
1055866918 9:80825671-80825693 CAATAGGTTTTTGGGGGAAGAGG - Intergenic
1055928700 9:81537741-81537763 CCACAGGTTTTTGGGGGAACAGG + Intergenic
1056178971 9:84063043-84063065 CCATACGTTTTGGGGGGAATGGG - Intergenic
1056387974 9:86115201-86115223 CCAGAGGCGTGAGGGGGAAATGG + Intergenic
1057328693 9:94091661-94091683 CCAGAGGTATAAGGAGGAACTGG - Intronic
1058396650 9:104561306-104561328 CAATAGGTTTTTGGGGGAACAGG - Intergenic
1058866779 9:109167862-109167884 GCCTAGTTTTGAAGGGGAACAGG - Intergenic
1203423791 Un_GL000195v1:19092-19114 GGATAGGTTTCAGGGGGAAGAGG + Intergenic
1186528948 X:10276159-10276181 CAATAGGTTTTTGGGGGAACAGG - Intergenic
1186587333 X:10889291-10889313 CCATAGGTTTTTGGGGAAACAGG + Intergenic
1186740265 X:12509711-12509733 CCATAGGTTATTGGGGGAACAGG - Intronic
1187134303 X:16531787-16531809 CAATAGGTTTTTGTGGGAACAGG - Intergenic
1188410126 X:29861674-29861696 CCATAGGTTTTTGGGGGAACAGG - Intronic
1189123856 X:38425036-38425058 CCATAGGCTGAATGGGGAACGGG + Intronic
1189133538 X:38525585-38525607 CAATAGGCTTTTGGGGGAACAGG + Intronic
1190135361 X:47791416-47791438 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1190589777 X:51988073-51988095 CAATAGGTTTTTGGGGGAACAGG + Intergenic
1190685761 X:52871405-52871427 CAATAGGTTTTTGGGGGAACAGG - Intergenic
1191063509 X:56323203-56323225 CCATAGGTACAAGGAGGAACTGG + Intergenic
1191087404 X:56584099-56584121 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1191100846 X:56726538-56726560 CTATAGGTTTTTTGGGGAACAGG - Intergenic
1191143844 X:57144534-57144556 CCATTGGTTTTTGGTGGAACAGG + Intergenic
1191727736 X:64299157-64299179 CCAGAGGTACAAGGGGGAACTGG - Intronic
1193877395 X:86877600-86877622 CCATAGGTTATTGGGGGTACAGG + Intergenic
1193989722 X:88291553-88291575 CCATAGGGTTTTTGGGGAACAGG - Intergenic
1195117415 X:101713656-101713678 CCAGAGGTACGAGGAGGAACTGG - Intergenic
1195342469 X:103918895-103918917 CCATAGCTCTGCAGGGGAACAGG + Intronic
1195873526 X:109513449-109513471 CCATAGGTTTTTTGGGGGACAGG - Intergenic
1196617227 X:117780362-117780384 CCAGAGGTTCAAGGAGGAACTGG + Intergenic
1196658966 X:118249832-118249854 CAATAGTTTTGAGGAGGAAGAGG - Intergenic
1198199364 X:134399927-134399949 CCAGAGGTTTGGGAGGGAAAAGG - Intronic
1198306418 X:135388213-135388235 CCAGAGGTACGAGGAGGAACTGG + Intergenic
1199584645 X:149401480-149401502 CCACAGGTTTTTGAGGGAACAGG - Intergenic
1199766245 X:150943539-150943561 CCCTAGGTTAAAAGGGGAACAGG + Intergenic
1200741216 Y:6855845-6855867 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1201773370 Y:17639979-17640001 CCATGTGTTTCAGGGGGAACAGG - Intergenic
1201828185 Y:18266007-18266029 CCATGTGTTTCAGGGGGAACAGG + Intergenic