ID: 923462626

View in Genome Browser
Species Human (GRCh38)
Location 1:234220391-234220413
Sequence GTGGTGACAAGGAGACATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923462626 Original CRISPR GTGGTGACAAGGAGACATGT TGG Intronic
902656236 1:17870280-17870302 GTGGGCACAAGGAAACATTTAGG - Intergenic
904289320 1:29473925-29473947 GTGGTGAAAAGGGGACATCGGGG + Intergenic
905965184 1:42087063-42087085 GTGATGAAAAGGGGACAGGTGGG - Intergenic
906746523 1:48225925-48225947 GTGGTGAGAAGGAGAAGGGTGGG - Intronic
906942016 1:50263834-50263856 GTGGGGAGAGGGAGACAGGTGGG - Intergenic
907113862 1:51951492-51951514 GTAGTGACAATGACACATGGTGG - Intronic
909923996 1:81416785-81416807 GTGGTGCCAAGTAGTCATATAGG + Intronic
911761945 1:101626872-101626894 GCAGTGACAAGGGGAAATGTGGG + Intergenic
912728179 1:112077430-112077452 GTGTTGACTAGGTGACATGGTGG - Intergenic
913581349 1:120230448-120230470 GTGGCAACAAGGAGCCATCTTGG - Intergenic
913626827 1:120667943-120667965 GTGGCAACAAGGAGCCATCTTGG + Intergenic
914563281 1:148841891-148841913 GTGGCAACAAGGAGCCATCTTGG - Intronic
914609546 1:149288332-149288354 GTGGCAACAAGGAGCCATCTTGG + Intergenic
914674289 1:149896531-149896553 GTGGAAACAGGGAGACAAGTTGG - Intronic
914941203 1:152024355-152024377 GTGGTGACTGGGAGAGATTTAGG + Intergenic
915066690 1:153230862-153230884 GTGAGGACTAGGAGATATGTGGG + Intergenic
915755348 1:158254434-158254456 TTGGTGACAAGGAGAGAAGCTGG + Exonic
915846197 1:159268125-159268147 GTTGTGAGATGGAGACATCTTGG - Intergenic
916553951 1:165876877-165876899 GTGAAGACACGGAGACATGAGGG - Intronic
916611751 1:166398320-166398342 GTGGTGAAAATGAGATTTGTAGG + Intergenic
916897478 1:169180345-169180367 GTGCTGACAAGGGGATTTGTGGG - Intronic
917535930 1:175874532-175874554 ATAGTGGCAAGGAGACCTGTTGG + Intergenic
920451092 1:206061744-206061766 GTGATGAAAAGGGGGCATGTTGG - Intronic
920659900 1:207906941-207906963 GAGGTGACAGGGAGAAATGTAGG - Intronic
920759346 1:208767273-208767295 GTGGTGTCAAGGGGAGAAGTAGG + Intergenic
923012959 1:230103642-230103664 GTGGTTCTAAGGAGACAAGTAGG + Intronic
923462626 1:234220391-234220413 GTGGTGACAAGGAGACATGTTGG + Intronic
923493481 1:234505039-234505061 GTGGTGAAAGGAAGACATCTTGG - Intergenic
1063214457 10:3911858-3911880 GGGTTGTCAAGGAGAAATGTTGG + Intergenic
1063783404 10:9352403-9352425 GTGGTGAGAAAGATACATGTAGG + Intergenic
1064363476 10:14686411-14686433 GTGGTGGCAAGGTGAGATTTGGG + Intronic
1065816543 10:29487927-29487949 GTGGTTACACAGAAACATGTGGG + Intronic
1065956322 10:30696728-30696750 GTGGTTACACAGAAACATGTGGG - Intergenic
1065984068 10:30931980-30932002 GTGCTCCCAAGGAGACAAGTAGG + Intronic
1067397432 10:45935144-45935166 GTGGTGACAAGGATAGTTTTAGG + Intergenic
1068175139 10:53447785-53447807 GCAGTGCCAAGGAGAAATGTGGG - Intergenic
1070311290 10:75275877-75275899 GTGGTGACAAAGACACAAGTTGG + Intergenic
1070522889 10:77269855-77269877 GTGGTTTCAAGGAGAGGTGTGGG - Intronic
1070529687 10:77325753-77325775 ATGGCGACAAGGAGACCTGTTGG - Intronic
1076022016 10:127081863-127081885 GTGGTGACGAGAGGACATTTGGG - Intronic
1078431572 11:11292284-11292306 CTGGTGACTAGGAGACCTCTGGG + Intronic
1078848786 11:15145050-15145072 GAGGTGAAAAGGACACATGTAGG - Intronic
1079548056 11:21659154-21659176 GTGGGGAAATGGAGAGATGTTGG + Intergenic
1081731315 11:45373729-45373751 TGGGTGACAAGGAGCCATGGAGG + Intergenic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084908612 11:72369207-72369229 GTGGTGTGAAGGTGAGATGTGGG - Intronic
1085481443 11:76825820-76825842 GTGGTTATAAGGAGACATGTTGG - Intergenic
1085816973 11:79747920-79747942 GTGTTGAGAAGGATAAATGTGGG + Intergenic
1087354892 11:97080183-97080205 GGGGTGACAAAGCTACATGTCGG + Intergenic
1089373111 11:117975588-117975610 GTGGTGGAATGGAAACATGTAGG + Intergenic
1090057637 11:123437375-123437397 GTGATGACAAGAAGACATCCTGG - Intergenic
1091271707 11:134318203-134318225 GGAGAGACAAGGAGACATCTAGG - Intronic
1091372173 11:135070170-135070192 ATGGTGAGGAGGAGACATGCAGG - Intergenic
1092196185 12:6551053-6551075 GTGGGGACAGGGAGCCATGGGGG - Intronic
1093474518 12:19539813-19539835 GTGGATACAAGGAGGCCTGTGGG + Intronic
1093691731 12:22116355-22116377 GAGGAGACAAGGAGACAAGCAGG - Intronic
1097046388 12:56190034-56190056 GTGGCGACTAGGGGACATTTGGG - Intergenic
1097233486 12:57525709-57525731 GTGGTGAGGAGGAGGCATGAGGG - Exonic
1097317932 12:58192493-58192515 GAGGTGACAAGTATACATATTGG - Intergenic
1099816306 12:87653039-87653061 TGGGTGACAAGGAGAGATGGTGG - Intergenic
1103377073 12:120465367-120465389 GTGGTGAGAAGGAAAGATGATGG - Intronic
1103467918 12:121156752-121156774 GTGGTGGCAGGGAGTCATGGGGG - Intronic
1105351930 13:19623692-19623714 GTGGGGAAAAGGAGGCAGGTGGG - Intergenic
1106152457 13:27118873-27118895 ATGGTGACAGGTGGACATGTGGG - Intronic
1106744982 13:32692579-32692601 TTGGTAACAAGGAGATTTGTGGG + Intronic
1107167066 13:37295145-37295167 GTGGAGGCAAGGAGACAAGACGG - Intergenic
1109792737 13:67270658-67270680 GTTGTCACCAGCAGACATGTTGG - Intergenic
1109919520 13:69037364-69037386 GTGCTGACAATAACACATGTTGG + Intergenic
1110565055 13:76949594-76949616 GTGGTGACATGGAGCCCTGGAGG - Intronic
1113706317 13:112435339-112435361 GGGGTGACCAGGACACATCTTGG + Intergenic
1116086412 14:40244327-40244349 GTGGTGACAACCAAAAATGTTGG + Intergenic
1119040403 14:71269521-71269543 GTGGTGAAGAAGAGAAATGTGGG + Intergenic
1119137189 14:72231867-72231889 GTTGCAACAAGGAGCCATGTTGG + Intronic
1121141512 14:91546614-91546636 GCAGTGAGAAGGAGCCATGTTGG + Intergenic
1121448309 14:93992384-93992406 GAGGTGACAAGGTGGCATGGAGG + Intergenic
1126879526 15:53079525-53079547 TTGGGGATAAGGAGACGTGTAGG - Intergenic
1127385739 15:58465183-58465205 GGGGTGACATGGACAGATGTAGG - Intronic
1129425707 15:75461190-75461212 GTGGTGACTGAGAGACATTTAGG + Intergenic
1130032357 15:80327597-80327619 TTGTTGATAAGGAAACATGTAGG - Intergenic
1130083257 15:80753911-80753933 GTGGGGACAAGGAGGTATCTGGG + Intronic
1131168563 15:90160356-90160378 GTGGTGACAAGAGGACAAGATGG - Intergenic
1132879062 16:2153286-2153308 GGGGTGACAAGGGGACACGATGG - Intronic
1133799104 16:9070525-9070547 GGGGTGACAAGGAAACAGGCTGG - Intergenic
1134092679 16:11399840-11399862 GTGGGGAAAGGGGGACATGTAGG + Intronic
1137642304 16:50043273-50043295 GTGGGGCAAAGGAGAAATGTGGG + Intergenic
1139317835 16:66088504-66088526 GTAGTCACAAGGAGACTTGAAGG + Intergenic
1139581611 16:67877127-67877149 GTGGTGGCAGGGAGACAGGTGGG + Intronic
1144280220 17:13719245-13719267 GAGGGGTCAAGGAGACATTTGGG - Intergenic
1144366236 17:14547535-14547557 GTGGTGACATGGAGGAAAGTTGG + Intergenic
1146074353 17:29714217-29714239 TTGGTTACTAAGAGACATGTTGG - Intronic
1149622682 17:58057912-58057934 CTGATGACAAGGAGAAATGGAGG - Intergenic
1150438081 17:65169504-65169526 GTGAGGATAAGGAGACATGGCGG + Intronic
1151327039 17:73385920-73385942 GTGGAGAGAAGCAGACAGGTGGG + Intronic
1157217105 18:45793380-45793402 GTGGTGACAGTCAGAGATGTTGG - Intergenic
1158904756 18:62001211-62001233 GTGGTGCAAAGGAGAAACGTGGG - Intergenic
1158957282 18:62552044-62552066 GTGGAGACAAGCAGAAATCTGGG + Intronic
1159223629 18:65500860-65500882 GTGAAGACATGGAGACCTGTTGG + Intergenic
1159860106 18:73638026-73638048 GTGGTGTCAAGGAGGCATCTTGG - Intergenic
1160905370 19:1449572-1449594 GGGGAGACAGGGAGAAATGTGGG + Intronic
1160971118 19:1768188-1768210 GGGGTGACAGGGAGAGTTGTGGG + Intronic
1163189779 19:15669307-15669329 ATGGTGACCAAGAGACATCTAGG + Intergenic
1163207373 19:15813581-15813603 GTGGAGACACAGAGAGATGTGGG + Intergenic
1163221220 19:15922555-15922577 GTGGTGACCAAGAGACATCTAGG - Intronic
1166171691 19:41032162-41032184 GTGATGACAAGGATAAAGGTGGG + Intergenic
1166864199 19:45826221-45826243 GAGCTGACAAGGACACAGGTTGG - Exonic
1167667697 19:50832253-50832275 GTGGTGCCAAGGATCCATGGAGG - Intronic
925480462 2:4265358-4265380 GGGGAGAAATGGAGACATGTTGG - Intergenic
928323782 2:30303977-30303999 GTGGTGACAAGGGGAGATGGGGG - Intronic
928722924 2:34141280-34141302 GTTTTGACAAGGAAACATGAAGG - Intergenic
929322309 2:40559014-40559036 GTGGTGACAAGGAGAAAGAAAGG + Intronic
931426772 2:62178625-62178647 GGGATGACAAGGAGACAGGCTGG + Intergenic
931591187 2:63885123-63885145 GTGGTGGGAAGCAGACATCTTGG + Intronic
932121058 2:69100493-69100515 GTGGGGCCAAGCAGACATGCAGG + Intronic
932271369 2:70413087-70413109 GTGGGGAGAAGGACACCTGTGGG + Intergenic
934753694 2:96810625-96810647 GTGGAGACAAGAGGACATGTGGG + Exonic
935931656 2:108133250-108133272 GTAGTGCCAAGGAGAAATGTGGG - Intergenic
937155207 2:119714145-119714167 TTGGTGACAGGGAGACAGGGTGG + Intergenic
939948865 2:148444677-148444699 GTGGTGGGCAGGAGACATCTAGG - Intronic
947946485 2:234107689-234107711 GTGGTGGAAAGGGGACATGTTGG - Intergenic
947985043 2:234440559-234440581 GTGGTGTCGAGGATAAATGTGGG - Intergenic
948015616 2:234688265-234688287 GTTGTGACATGGTGACATGGTGG - Intergenic
948384379 2:237572613-237572635 TTGGGGACAAGGAAACATCTTGG - Intergenic
1169668531 20:8068069-8068091 TTGGTGACAGGGAGACCAGTTGG + Intergenic
1170121117 20:12913364-12913386 GTTGGGACAAGGAGACAAGGAGG - Intergenic
1172406482 20:34693637-34693659 CTGGTGACAGGGAGCCAAGTGGG - Intergenic
1172431011 20:34891807-34891829 GTGGTGAAAATGAGACAAGTAGG + Intronic
1173804104 20:45912643-45912665 GTGGTGACACAGAGACAGGTAGG - Intergenic
1174227766 20:49017497-49017519 TTGCTGACATGGAGACCTGTAGG + Exonic
1174742416 20:53028141-53028163 GTGGTGGATAGCAGACATGTGGG + Intronic
1175978996 20:62727704-62727726 GTGGTGGCAGGGGGACCTGTGGG + Intronic
1177406375 21:20673510-20673532 GTAGTGCCAAGGGGAAATGTAGG + Intergenic
1178738681 21:35176383-35176405 GTGGTGACAGTGGGACCTGTGGG + Intronic
1179398425 21:41062023-41062045 GGGGAAACAAGGAGCCATGTTGG - Intergenic
1182088284 22:27576457-27576479 ATGGTGTCACGGAGACATCTGGG + Intergenic
1184208851 22:43023493-43023515 GGGGGGACAGGGAGACAGGTGGG - Intergenic
950116873 3:10456682-10456704 GAGGTGACAAGGAGCCTGGTGGG - Intronic
951919688 3:27840778-27840800 GAGGAGACAAGGAGACCAGTAGG + Intergenic
952165742 3:30746581-30746603 GGGGTGATAAGGTGACAGGTGGG + Intronic
952820670 3:37483183-37483205 GTTGTGACAGGGACACATGATGG + Intronic
954081945 3:48217623-48217645 TTGCTGACAAGGAGACAGGCTGG + Intergenic
957590874 3:82196178-82196200 GTGGAGAAAAGGAGGCATGTAGG - Intergenic
957731481 3:84143891-84143913 GGGATGACATGGAGACCTGTTGG - Intergenic
961492857 3:127267276-127267298 GTGATGGCAAGGAGACAAGTTGG + Intergenic
962380447 3:134894243-134894265 GTGGTGAAAAGGGGACATCCAGG - Intronic
962928119 3:140013475-140013497 GTGGAGACAGGGACACATGTGGG + Intronic
964293285 3:155205576-155205598 ATGGTGACATGCAGACATGTAGG - Intergenic
966407976 3:179618910-179618932 CTGGTGACAAGGAGACTATTAGG + Intronic
967087394 3:186108131-186108153 GGGGTGCCAGGGAGAGATGTTGG - Intronic
967577217 3:191107992-191108014 GCTGTGCCAAGGAGAAATGTGGG + Intergenic
969597203 4:8156236-8156258 GTGGTCACAAGGGGACCAGTAGG - Intronic
974087123 4:57273329-57273351 ATGGTGACCAGCAGAGATGTGGG + Intergenic
975122757 4:70746897-70746919 GTAGGGGCAAGGAGAGATGTGGG + Intronic
980088635 4:128418081-128418103 GTGGAGAAAAGGTGACATGTGGG - Intergenic
981812824 4:148794958-148794980 TTGGAGACAAAGAGATATGTTGG + Intergenic
982417807 4:155157484-155157506 GCAGTGCCAAGGAGACATGTAGG + Intergenic
982569638 4:157032144-157032166 GTGGTGAGAGGGAAATATGTAGG + Intergenic
986741243 5:10707291-10707313 GTGTTGAGAGGCAGACATGTGGG + Intronic
987389844 5:17365617-17365639 CTGGTGACAAGGACTCATGCTGG - Intergenic
987416237 5:17664386-17664408 GTGGTGAAAAGGAAACGTTTAGG - Intergenic
987558090 5:19481495-19481517 CTGGTGACAAGAGGGCATGTAGG - Intronic
987663276 5:20904924-20904946 GTAGTGACAAGGGGAAATGTGGG - Intergenic
988231855 5:28489838-28489860 GTGGTGAAAATGGGACATTTGGG - Intergenic
988759413 5:34297261-34297283 GTAGTGACAAGGGGAAATGTGGG + Intergenic
989229054 5:39066038-39066060 GTGGGGCCAAGGGGAAATGTGGG - Intronic
990470516 5:56111148-56111170 GTGGTGGCACGGAGACCTCTTGG + Exonic
991028728 5:62059668-62059690 GTGGTGAGAAGGAAAGATGGAGG - Intergenic
991640642 5:68748342-68748364 GTGCTTACAAGGAGAGATGCTGG - Intergenic
993751564 5:91675392-91675414 GTGGATATAAGGAGGCATGTGGG - Intergenic
994797956 5:104330748-104330770 GTTTTGACAAGCGGACATGTAGG + Intergenic
994867550 5:105296072-105296094 GTGGTGACAAGGTGATAGGGAGG + Intergenic
996787916 5:127260461-127260483 GTTATGACAATGAGACATGAAGG - Intergenic
997270654 5:132534762-132534784 GTGCTGACAAAGAGACAGATAGG - Intergenic
998418532 5:141962904-141962926 GTGGAGATAAGGATGCATGTCGG - Intronic
999738881 5:154534238-154534260 GTGGTGACAGGGAGACCAGTTGG + Intergenic
1000809734 5:165846085-165846107 GAGGTGACAAGAATAGATGTGGG + Intergenic
1006780811 6:36631217-36631239 GTGGGGACAGGGGGACAAGTGGG - Intergenic
1007359788 6:41346669-41346691 GTGCTGACAGTGAGACATTTCGG - Intronic
1009296843 6:61961609-61961631 GTGCTGAAATGGAGACTTGTGGG + Intronic
1010063584 6:71653939-71653961 GTAGTGAGAATGAGACATCTAGG - Intergenic
1012258441 6:97060683-97060705 TTGGTGACCAGAGGACATGTTGG + Intronic
1012677683 6:102137661-102137683 GCAGTGCCAAGGAGAAATGTAGG - Intergenic
1014207862 6:118676311-118676333 GTTGGGAAAAGGAGAGATGTTGG - Intronic
1014378392 6:120706397-120706419 GAGGAGAAAAGGAGAGATGTTGG + Intergenic
1015519260 6:134114768-134114790 GTGGTGACAAAGACACAGGTTGG + Intergenic
1015908819 6:138146363-138146385 GTGGTGACAGGGAGACAGAGAGG + Intergenic
1016014322 6:139168064-139168086 TTGGTGGGAAGGAGACAGGTGGG - Intronic
1017948918 6:159119133-159119155 GTGGTGGCAAGGAGAAGTGCAGG + Intergenic
1019153897 6:170026189-170026211 GTGGTGATAAGATGACATCTGGG + Intergenic
1020617000 7:10471417-10471439 GTGGTGACAAGATGACATAAAGG - Intergenic
1022383271 7:29880650-29880672 CTGGTGACAAGCAGACCAGTAGG - Intronic
1023013843 7:35946189-35946211 GTGGAAACAAGGAGCCATATAGG + Intergenic
1024067147 7:45748795-45748817 GTGGAAACAAGGAGCCATATAGG - Intergenic
1024085622 7:45889375-45889397 GTGCTGGCAAGGAGACTGGTGGG - Intronic
1024516645 7:50265016-50265038 GAGGTGACAAGGAGAGGTGAGGG + Intergenic
1026052825 7:66961285-66961307 GTGGAGACTAGGAGTCCTGTAGG + Intergenic
1027586665 7:80066509-80066531 GCAGTGCCAAGGAGAAATGTGGG - Intergenic
1027950082 7:84804202-84804224 GGGCTGACAAGGAGAGTTGTAGG + Intergenic
1034294268 7:149957977-149957999 GGCCTGACAAGGAAACATGTCGG - Intergenic
1039612525 8:38930988-38931010 GAGGTGGCCAGGAGACATGGTGG + Intronic
1041006384 8:53500370-53500392 GTGGTGAGATGGGGAGATGTAGG - Intergenic
1041740558 8:61152509-61152531 GTGGTGATAAGGCGCCATCTTGG - Intronic
1041914211 8:63123225-63123247 GTGGTGAGAAAGCGACATATTGG + Intergenic
1042178590 8:66061910-66061932 GTGATGACAAGGAGGCATTCAGG + Intronic
1042449801 8:68931120-68931142 GTGATGACAAAGGGACAGGTGGG - Intergenic
1044649371 8:94478193-94478215 GTAGTGGCTAGGAGACAAGTGGG - Intergenic
1046320605 8:112569210-112569232 GTGGTGACATGGTCACAAGTTGG - Intronic
1047171884 8:122501820-122501842 GGAGTGAGAAGGAGACATGAAGG - Intergenic
1047448023 8:124937377-124937399 GTGGGGACAAGCAGCCTTGTGGG + Intergenic
1047688272 8:127323291-127323313 GTAGTGCCAAGGAAAGATGTGGG + Intergenic
1047940473 8:129823739-129823761 GTGGTGCCAAGGGGAAATGTGGG + Intergenic
1048043505 8:130752498-130752520 GTGGGGACAAGGAGTCAGGGTGG + Intergenic
1050894282 9:10867157-10867179 GTGAAGACAGGGAGAAATGTAGG + Intergenic
1051276567 9:15404578-15404600 GAGGTGCCAAGGTGACAAGTAGG - Intergenic
1051358335 9:16260253-16260275 GAGGTACCAAGGAGACACGTGGG - Intronic
1052684016 9:31731144-31731166 GTGGTGACAATGGGACCTGCTGG + Intergenic
1054765818 9:69041652-69041674 GGGGTGACAAGGGGACACCTGGG + Intronic
1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG + Intergenic
1057058717 9:91983996-91984018 ATGGTGACTAGGAAATATGTGGG - Intergenic
1061159005 9:128882535-128882557 GGGATGACAAGGGGACATGGGGG - Exonic
1061296251 9:129678431-129678453 TTGGTGTGAAGGAGACATGCTGG + Intronic
1187024844 X:15424378-15424400 GTGGTTACCAGAAGACATGAAGG + Intronic
1190512855 X:51191961-51191983 GTAGTGCCAAGGGGAAATGTGGG - Intergenic
1191783392 X:64892512-64892534 ATGGGGACAAGGAGAACTGTTGG + Intergenic
1194168911 X:90557454-90557476 GTAGTTCCAAGGAGAAATGTGGG + Intergenic
1194301768 X:92196185-92196207 GTGGAGACAAGGAGAAAGGTTGG - Intronic
1194373854 X:93109172-93109194 GTCCTCACAAGGAGAAATGTTGG - Intergenic
1194856258 X:98932991-98933013 GCAATGACAAGGGGACATGTGGG + Intergenic
1195067610 X:101251931-101251953 GTGATGACAGGGAGAGTTGTGGG - Intronic
1197381887 X:125754636-125754658 GTGCTGCTAAGGACACATGTGGG - Intergenic
1198828248 X:140721125-140721147 GTGGAGACAAGCAAACATTTTGG - Intergenic
1199329529 X:146542833-146542855 GTAGTGGCAAGGGGAAATGTGGG - Intergenic
1199977196 X:152901030-152901052 GTGGTGGCAAGGAGTGAAGTGGG + Intergenic
1200515154 Y:4135239-4135261 GTAGTTCCAAGGAGAAATGTGGG + Intergenic
1200681883 Y:6223234-6223256 GTCCTCACAAGGAGAAATGTTGG - Intergenic