ID: 923469937

View in Genome Browser
Species Human (GRCh38)
Location 1:234281450-234281472
Sequence ATGGGTACAAAGAGCAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923469937_923469939 -6 Left 923469937 1:234281450-234281472 CCTTGTTTGCTCTTTGTACCCAT 0: 1
1: 0
2: 0
3: 20
4: 239
Right 923469939 1:234281467-234281489 ACCCATTTGGCAGAGCAGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923469937 Original CRISPR ATGGGTACAAAGAGCAAACA AGG (reversed) Intronic
903360802 1:22775897-22775919 ATGGGCACTAAGAGCAGCCAAGG + Intronic
905779419 1:40694713-40694735 ATGGGTATAAGGGGCTAACATGG - Intronic
908563552 1:65331202-65331224 ATGGCTACAAAGAACCAACCAGG - Intronic
910016218 1:82527849-82527871 ATGGACACCAAAAGCAAACAGGG - Intergenic
910188732 1:84573915-84573937 CTGGGTGTAAAAAGCAAACAAGG - Intronic
911620749 1:100064514-100064536 ATGGGGACAGATGGCAAACAGGG - Intronic
911820244 1:102410147-102410169 ATGGTTACAAACAACAAAAAAGG + Intergenic
912471183 1:109908066-109908088 ATGGGTACAAACAGCTTGCATGG + Intergenic
914958311 1:152184491-152184513 ATGGAAAAAAAGAGGAAACATGG + Intergenic
915935145 1:160086076-160086098 GGGGGTACAAAGAGAAAAGAGGG - Intronic
916756278 1:167773180-167773202 ATTGCTACAGAGAGAAAACATGG - Intronic
917364492 1:174214958-174214980 ATGGGCAAAAAAAGCAAAAATGG + Intronic
918534650 1:185560796-185560818 ATGGGTGCAGAGAGCAATCGGGG - Intergenic
918908656 1:190534100-190534122 ATGTGAACAATGAACAAACAGGG + Intergenic
919148947 1:193670602-193670624 ATGGGTACAGTAAGCCAACATGG - Intergenic
922204510 1:223434939-223434961 ATGGGTACAAAGTGAAGGCAAGG + Intergenic
922216560 1:223524824-223524846 ATGGAGACAAAGGCCAAACAGGG + Intergenic
922690278 1:227683632-227683654 ATGTGTAGAAAGAGAAAATATGG + Intergenic
922957388 1:229614805-229614827 AAGCTAACAAAGAGCAAACAGGG + Intronic
923251157 1:232180633-232180655 CTTGGTACAAAGAGCAAAAGAGG - Intergenic
923253646 1:232200014-232200036 ATGGAAACAAAAAGCAATCAAGG + Intergenic
923469937 1:234281450-234281472 ATGGGTACAAAGAGCAAACAAGG - Intronic
923811872 1:237327209-237327231 CTGGGTACAAAGAGAAAGCATGG + Intronic
924626806 1:245702414-245702436 ATGGAGACGCAGAGCAAACAGGG - Intronic
924789059 1:247226985-247227007 ATGGGTACAGCAAGCCAACATGG + Intergenic
1066074466 10:31859168-31859190 ATGGGTACCAAGAGAAAGAAGGG + Intronic
1066706104 10:38179679-38179701 ATAGAAACAAAGAGCAAACTGGG + Intergenic
1067760017 10:49037992-49038014 ATTCCTACAAAGAGCACACAGGG - Intronic
1068372306 10:56132499-56132521 AAGGGAAAAAAGAGGAAACAGGG - Intergenic
1069338364 10:67380662-67380684 ATGAGTACTAAGGGCAAATAGGG + Intronic
1070763257 10:79039076-79039098 ATGTGTGCAAAGAGAACACATGG - Intergenic
1071112324 10:82174355-82174377 ATGTGCATAAAGAGGAAACAAGG - Intronic
1073415931 10:103382173-103382195 ATGGCTAAAAAGAACAAATAAGG + Intronic
1073633047 10:105167878-105167900 GTGGGTACAAGGAGAAACCAGGG + Intronic
1077687889 11:4314819-4314841 ATGGGTGCAACAAACAAACACGG + Intergenic
1077925951 11:6682340-6682362 CTCGGTACAAAGATCAAACTGGG - Exonic
1079241039 11:18722133-18722155 ATGGGAACAAAGAGCATTTAGGG + Intronic
1081130824 11:39377926-39377948 ATGGCTACTAAGAGCCAACCTGG - Intergenic
1085761222 11:79243144-79243166 ATGGGGACAAGGAGCACACAAGG - Intronic
1086520665 11:87664729-87664751 AAGAGTGCAAGGAGCAAACACGG - Intergenic
1086561079 11:88170174-88170196 ATGTGTACAGTGAGCAAAAATGG - Intronic
1086584412 11:88434330-88434352 ATGGGTAGAAAGAGCACTTAGGG + Intergenic
1086767155 11:90710316-90710338 ATGGGTACAAAAAGCAATTGGGG - Intergenic
1088639383 11:111856755-111856777 GTGGGAACAAAGAGTATACAAGG + Intronic
1090182741 11:124715198-124715220 ATGGCTCTAAAGAGTAAACACGG + Intergenic
1091672542 12:2462591-2462613 ATCTGTAGAATGAGCAAACATGG + Intronic
1091710655 12:2737848-2737870 GTGGGTACAAACAACACACAGGG + Intergenic
1092952710 12:13522463-13522485 ATGGAAACAGAGAGCAAACTGGG - Intergenic
1092995487 12:13946061-13946083 ATGGGTCAAAAGAGGAAACAAGG + Intronic
1094274084 12:28649192-28649214 ATAGGTACAAAGAGTAGATAAGG - Intergenic
1095968751 12:47886910-47886932 ATGGCTACAAAGAGCTATCTAGG - Intronic
1096499719 12:52057318-52057340 ATGGGCACGAAGAGCGATCAGGG - Intronic
1097277966 12:57826109-57826131 TTGGTTGCAAAGAGAAAACAAGG + Intronic
1098270100 12:68761816-68761838 ATGTGGAGAAAGAGAAAACAAGG + Intronic
1098542602 12:71674364-71674386 ATGGGTACAAAAATCAAAAATGG - Exonic
1099583019 12:84477259-84477281 ATGGGTGCAAAAAGCCACCATGG + Intergenic
1099754254 12:86822513-86822535 ATGGGAACAAAAAGAAAGCAGGG + Intronic
1099766687 12:86996351-86996373 ATTGGTATAAGGAGAAAACAAGG + Intergenic
1100977227 12:100135103-100135125 ATGCGATCAAAGAGAAAACAAGG - Intronic
1101181623 12:102225248-102225270 CAGGGTACAAAGACAAAACAGGG - Intergenic
1102786527 12:115609536-115609558 ATGAGTCCAGAGAGCCAACAGGG + Intergenic
1104917723 12:132274456-132274478 AGGGGTGCAAAGAGCAAGCCGGG - Intronic
1106793731 13:33183227-33183249 AGTGGTACAAAGAGTAAATAAGG - Intronic
1107978124 13:45709407-45709429 AAGGGTCCAAAGAGGAATCATGG - Intronic
1108040062 13:46331642-46331664 ATGGGGACCAAGAGCCACCAAGG - Intergenic
1108254583 13:48598221-48598243 AAGGATACAGACAGCAAACAGGG + Intergenic
1108923454 13:55706565-55706587 ATTGAGACAAACAGCAAACAGGG + Intergenic
1109702996 13:66050841-66050863 AGGGGTACAAAGAACGAAAATGG + Intergenic
1112042881 13:95565704-95565726 ATGGGTACAGCCAGCCAACATGG - Intronic
1112234170 13:97620738-97620760 ATGGGTACATGCAGCAATCAAGG + Intergenic
1113057909 13:106289360-106289382 ATGGATACAACGAGGAAAAATGG - Intergenic
1115400536 14:32954320-32954342 ATGGGTAAATAGAACAAACCAGG - Intronic
1116656888 14:47665400-47665422 ATGGGTACAGAGAGTAAGCGAGG - Intronic
1119753418 14:77097660-77097682 ACGGGAACAAAAAACAAACAGGG + Intergenic
1121132181 14:91458482-91458504 ATGGAAACAAAAAGCCAACAGGG - Exonic
1125763964 15:42120617-42120639 ATGGGTAAATATAGCAACCATGG - Intergenic
1126420481 15:48467099-48467121 GTTGGTACAAAGAGCACACCTGG - Intronic
1126760435 15:51965068-51965090 ATATGTAGAAAGTGCAAACATGG - Intronic
1127053555 15:55109685-55109707 ATGGAAACAAACAACAAACAAGG - Intergenic
1127188506 15:56505835-56505857 AAGGCTACAAACAGCAAAAATGG - Intergenic
1127719485 15:61685838-61685860 ATGGCTACACAGAGAGAACAGGG - Intergenic
1129434095 15:75523940-75523962 ATAGGAACAAAGTCCAAACAGGG + Intronic
1129761084 15:78129713-78129735 TTGGGAACAAAAAGCACACATGG + Intronic
1132126459 15:99230667-99230689 AGGGGAATAAAAAGCAAACAAGG + Intronic
1133310180 16:4840459-4840481 TTTGGTAAAAAGAGCAAACCTGG + Intronic
1138874642 16:60934865-60934887 ATGAGTACAACGAGGAAATATGG + Intergenic
1142249899 16:88986447-88986469 AGGGGGACAAGGAGCAGACAAGG - Intergenic
1142585360 17:969062-969084 AGGGGTACAAAGAGGTAAAAAGG + Intronic
1143477211 17:7209486-7209508 ATGGGTAAAAAGAGAAGGCACGG + Intronic
1143754482 17:9056501-9056523 ATGGGTACAAAGCAGAAGCAGGG + Intronic
1144404675 17:14941201-14941223 ATGGATCCAAAGACCAAAGACGG + Intergenic
1144457563 17:15431560-15431582 ATGGGAACAAGGAGCAAGCTGGG + Intergenic
1145209748 17:21004324-21004346 ATGGTTAACAACAGCAAACAGGG + Exonic
1145398467 17:22513575-22513597 ATGGGTGCAACAAGCCAACATGG - Intergenic
1145852605 17:28116164-28116186 TTATGTACAAAGAGCTAACATGG + Intronic
1146514840 17:33480930-33480952 ATGAGGTCAAAGAGCAAACCTGG - Intronic
1147551621 17:41446688-41446710 ATGGTTCCAAAGAGCAGCCATGG + Intergenic
1149759255 17:59214705-59214727 ATAGGTTCAAAGAACATACAAGG - Intronic
1150033079 17:61761958-61761980 ATGAGTAAAAAGAACAAAAATGG + Intronic
1150720432 17:67609816-67609838 TTGGGTACAAAAAGCAAACCTGG - Intronic
1151846238 17:76657887-76657909 GTGGGTACAAAGAGCCCAGATGG - Intergenic
1154937479 18:21075980-21076002 AGAGGTACACAGAGCAAAAATGG + Intronic
1159603120 18:70447671-70447693 TTGAGCACAAAAAGCAAACAAGG - Intergenic
1165483942 19:36084024-36084046 AACGGTACCAAGAGCCAACATGG + Intronic
1165967765 19:39598051-39598073 TTATGTACAAAGAGCTAACACGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926281925 2:11456115-11456137 ATGGGTAGACAGAGCAGACCAGG - Intronic
931362436 2:61589423-61589445 TTATGTACAAAGAGCAATCATGG + Intergenic
932587678 2:73042096-73042118 ATGGGGAGAAAGAGAAAAAAAGG + Intronic
933069152 2:77835986-77836008 ATGGATACTAAGAGGAAAAATGG + Intergenic
933555409 2:83824705-83824727 AGGTGTACATAGAGCAAATAGGG + Intergenic
933669396 2:84992511-84992533 ATGGTTACTAAGAGCCAAAACGG - Intronic
935212226 2:100947840-100947862 ATGGCTCCAAAGAGCCCACAGGG - Intronic
935464233 2:103376967-103376989 ATAGATACAAAGTGAAAACATGG - Intergenic
935863624 2:107361428-107361450 ATTTGTACAAACAACAAACAAGG - Intergenic
938607801 2:132914491-132914513 AGGGGGCCAAAGAGAAAACAGGG - Intronic
941697866 2:168572759-168572781 ATGGATGCAAACAGCGAACACGG - Intronic
942392421 2:175509492-175509514 ATGGGTGCAAAAAACCAACATGG + Intergenic
943318822 2:186421292-186421314 ATGAAAATAAAGAGCAAACAAGG + Intergenic
943486245 2:188486912-188486934 ATGGGTAGCAAGGGCAAAAAAGG + Intronic
945063484 2:205928456-205928478 AGACGAACAAAGAGCAAACAGGG + Intergenic
945442070 2:209892010-209892032 ATGTATGCAAAGGGCAAACAGGG + Intronic
947634182 2:231671867-231671889 CTGGGTGCAAAATGCAAACATGG + Intergenic
948447273 2:238042758-238042780 ATGGGTGCAAAGAGGAAGCAAGG - Exonic
1169399831 20:5270433-5270455 ATGGGTACACAGAGGACACATGG - Intergenic
1169523734 20:6400783-6400805 ATGAGTACAAAGAGCTTACTTGG - Intergenic
1169607675 20:7340600-7340622 CTGGGTACAAAAACCAGACAAGG + Intergenic
1172517646 20:35546219-35546241 ATCGGATCAAAGAGCAAAAAAGG + Intronic
1173138763 20:40463490-40463512 TGGGCTCCAAAGAGCAAACAGGG - Intergenic
1173815166 20:45982830-45982852 ATGGGTAGAAATAGCAACCAGGG + Intergenic
1175140197 20:56855300-56855322 TTGGGTTCCAAGAGCAAACCAGG - Intergenic
1176359212 21:5980423-5980445 ATGGAAACAAAAAGCAAGCAGGG - Intergenic
1178171267 21:30042449-30042471 AGGGAAACAGAGAGCAAACAAGG - Intergenic
1178399556 21:32273522-32273544 CTGGGGACTAAGACCAAACATGG + Intronic
1179764306 21:43558127-43558149 ATGGAAACAAAAAGCAAGCAGGG + Intronic
1179917046 21:44484598-44484620 GTGTGTTCAAAGAGCAAAGAAGG + Intergenic
1184825597 22:46948657-46948679 ACGGGGACAAAGACCAAAGAGGG - Intronic
950959320 3:17088429-17088451 ATGGGAAAAAATAGCAAGCAAGG + Intronic
951527614 3:23668841-23668863 ATGGCTTCCAAGGGCAAACAAGG - Intergenic
951609325 3:24473893-24473915 GTGGGAACAAAGAGAACACATGG + Intronic
951717718 3:25665938-25665960 ATGGGTTCAAAGTAAAAACAAGG + Intergenic
952596125 3:35019754-35019776 AAGGGTACAGAGAGCTAGCAAGG - Intergenic
952649056 3:35700938-35700960 ATGGGTACAGCAAGCCAACATGG + Intronic
953756427 3:45650415-45650437 ATGGGTACAGTAAGCCAACATGG - Intronic
953792303 3:45957636-45957658 TTGGGTACAAAGAACTGACAAGG - Intronic
953831601 3:46302054-46302076 ATGGGCACAAAGAAACAACAAGG - Intergenic
955657021 3:61254897-61254919 ATGGCTACAAAAAGTAAACAGGG + Intergenic
956460354 3:69465469-69465491 ATGGGTTCAGTAAGCAAACATGG - Intronic
956596208 3:70970338-70970360 ATGGGTTTAAAGAGAAAGCAGGG - Intronic
956912940 3:73839505-73839527 ATGGGCAACAAAAGCAAACATGG + Intergenic
957381837 3:79440947-79440969 ATGGTTTCAAAGTGCAAACTGGG - Intronic
957760922 3:84555492-84555514 ATGGGAATAAAGAGAAAACAAGG - Intergenic
958088105 3:88839026-88839048 ATGGACACCAAAAGCAAACAGGG - Intergenic
960299031 3:115979171-115979193 ATGGGGAAGAAGAGCAAAGAGGG + Intronic
960860896 3:122152513-122152535 ATGGGTACCAAGACCACTCAAGG - Intergenic
961468832 3:127098659-127098681 ATGCCTACAAAGATCAAAAATGG - Intergenic
962503698 3:136023576-136023598 ATTGATTCAAAGTGCAAACAAGG - Intronic
962911740 3:139858266-139858288 GTGGGAACAAATAGAAAACAGGG - Intergenic
965199709 3:165642031-165642053 ATGGGTGGAAAGAGGAAACCTGG - Intergenic
965387320 3:168060293-168060315 ATGGGTACAAGATGCAAGCAGGG + Intronic
965507229 3:169530019-169530041 ATTGGTATGAAGAACAAACATGG + Intronic
967474440 3:189900206-189900228 ATGGGTACAAAGAGGAAGCTAGG - Intergenic
971056620 4:22920606-22920628 ATGGGTGCAAAACACAAACATGG - Intergenic
972564420 4:40257554-40257576 ATGGATACAATTAACAAACATGG - Intergenic
972725308 4:41742198-41742220 ATTGGCAAAAAGAGCAATCAAGG - Intergenic
975959165 4:79879919-79879941 ATGGGGACAAAGTGCATAGATGG + Intergenic
976379876 4:84387232-84387254 ATGGGTAAAAAGAGAAAACGAGG + Intergenic
976434256 4:84998869-84998891 CTGGGAACAAAGAGGAAATAAGG + Intergenic
976675153 4:87694842-87694864 CAGGGTCCAAAGAGAAAACATGG + Intergenic
979155658 4:117386278-117386300 ATGGGTACAAAGATGAAAGTAGG + Intergenic
979606505 4:122644231-122644253 ATGAGTAGAAAGAGAAAAGAGGG - Intergenic
981242086 4:142490133-142490155 AGGAGCACAAACAGCAAACATGG + Intronic
981382548 4:144090258-144090280 ATTGGTACAAAGAGGAGGCAAGG + Intergenic
981546652 4:145900830-145900852 ATGGGTAAAATTAGGAAACAAGG - Intronic
981825048 4:148930447-148930469 ATGGACACCAAAAGCAAACAGGG + Intergenic
982529977 4:156528003-156528025 ATGAATTCTAAGAGCAAACATGG + Intergenic
987826004 5:23031153-23031175 AAGCGGACAAAGAGAAAACATGG - Intergenic
988366322 5:30305141-30305163 ATGGGGAAAAAGAGAAAGCATGG - Intergenic
990237652 5:53784793-53784815 ATGTCTATACAGAGCAAACAGGG - Intergenic
990513781 5:56513682-56513704 ATGGGTAAGAAGAGGAAAAATGG + Intronic
992799824 5:80286074-80286096 AAGGGTACCAAGAACATACATGG + Intergenic
994133968 5:96263544-96263566 AGGGGCACAAAGAGAAAAGAAGG + Intergenic
995314432 5:110751998-110752020 ATGGGAAGAAGGAGCAAACAAGG + Intronic
995893663 5:116985802-116985824 ATGGGAACAATGAGAACACATGG - Intergenic
996124998 5:119715037-119715059 ATGGGGACAAAGGGTACACAAGG - Intergenic
996440358 5:123483097-123483119 ATACGTACAAAAAGCTAACATGG - Intergenic
997029574 5:130110090-130110112 ATGGGTATGAAGAGCAAACCTGG + Intronic
999008351 5:148006529-148006551 TTGGGTACAAAGGGAAAAAAGGG - Intergenic
999987238 5:157015381-157015403 ATGGGTACAGCAAACAAACATGG + Intergenic
1004761601 6:18672859-18672881 ATGAGGAGAAAGAGAAAACATGG - Intergenic
1005383995 6:25267776-25267798 ATGGGTACAGAAAACAACCATGG + Intergenic
1006233652 6:32607982-32608004 ATGGGTAGAAAGAGAAAATGTGG + Intergenic
1006729750 6:36228072-36228094 ATTGGTACTAAAACCAAACAAGG - Intronic
1008362993 6:50643701-50643723 ATGGGTGCAACGAACCAACATGG - Intergenic
1008583699 6:52929772-52929794 TTACGTACAGAGAGCAAACAGGG + Intergenic
1009969045 6:70606843-70606865 ATGGACACAAAAAGCAAGCAGGG + Intergenic
1011844048 6:91540065-91540087 ATGGGCAGAAAGACCAAACATGG + Intergenic
1012078430 6:94725452-94725474 ATGTGTACAAAGAGATCACATGG + Intergenic
1012300503 6:97581668-97581690 ATGGGTACAACAAACCAACATGG + Intergenic
1012617187 6:101291764-101291786 AGGGGTATGAAGAGCAAGCAGGG + Intergenic
1014260148 6:119207184-119207206 ATGTGTACAAAGAGGAAGGAAGG - Intronic
1015090954 6:129358133-129358155 ATGAGTAGAAGGTGCAAACAAGG - Intronic
1015376410 6:132514983-132515005 AAAGGTAAATAGAGCAAACAGGG + Intergenic
1015446060 6:133306155-133306177 ATTAGTACAAAGTACAAACAAGG + Intronic
1015511823 6:134045319-134045341 ATGGGTCAAGAGAGCAAACCTGG + Intronic
1016655078 6:146509558-146509580 ATGGGTGCAACCAGCCAACATGG - Intergenic
1018430744 6:163719803-163719825 ATGTGTACAAATAGAAAACTGGG + Intergenic
1019170861 6:170132463-170132485 CTGGGTACAAAGAGGAAAGGGGG + Intergenic
1021308723 7:19064558-19064580 ATGGTTACAAAGAACATACGTGG - Intronic
1023321518 7:39003173-39003195 ATGTGTACAAAAAGCCATCAAGG + Intronic
1024745161 7:52398067-52398089 ATGGACACCAAAAGCAAACAGGG - Intergenic
1026276118 7:68878581-68878603 ATGGGTGCAACAAGCCAACATGG - Intergenic
1026842354 7:73677089-73677111 AGGAGTACAAAGAGCAGACTGGG - Intergenic
1031069587 7:117147128-117147150 AGAGGTACATAGAGCAAAAATGG - Intronic
1031252740 7:119408815-119408837 ATGGGTACAAGTAGCAGTCATGG + Intergenic
1032693058 7:134308775-134308797 ATGGGGCCAAATAGAAAACAGGG - Intronic
1034408747 7:150924886-150924908 ATGGGGACAAAGAGAAGACAAGG + Intergenic
1036635073 8:10543770-10543792 ATGAGTAAAAAGAGCTTACATGG - Intronic
1037100325 8:15035662-15035684 ATGGACACAAAAAGAAAACAAGG + Intronic
1037704454 8:21307464-21307486 GTGGGTACCAAAAGCAAACAAGG - Intergenic
1041581852 8:59470095-59470117 ATGTGAACAAAGAGAACACATGG - Intergenic
1043687731 8:83108612-83108634 ATGGGTACAAACAGCAAGAAAGG - Intergenic
1045230600 8:100302840-100302862 AAGTATACAAAGAGCAAAGAAGG + Intronic
1046034826 8:108827972-108827994 ATGGTTTCAGAGAGGAAACATGG + Intergenic
1046463911 8:114577213-114577235 AGGGTTACCAAGAGCAAACTGGG + Intergenic
1048786111 8:138052246-138052268 ATGGGTTCAAGGAGAGAACAAGG - Intergenic
1050177096 9:2879658-2879680 ATGGGTACAAAGTGGAGACCTGG + Intergenic
1050578108 9:7020912-7020934 ATGGGTACAAAAAAAAAAAAAGG - Intronic
1050674947 9:8041701-8041723 ATGGGTACAGCAAGCCAACATGG - Intergenic
1051176614 9:14367291-14367313 GTGGGTACAAAGACTAAATATGG + Intronic
1051185991 9:14461880-14461902 AAGAGTCCAAAGAGCAACCAGGG + Intergenic
1051202250 9:14640279-14640301 ATAGGTTCAAAAAACAAACAAGG - Intronic
1053342691 9:37351250-37351272 ATGGGACCAAAGAGAAAAAATGG - Intronic
1053518116 9:38749204-38749226 ACAGGTACACAGAGCACACAGGG - Intergenic
1054864192 9:69983292-69983314 TTGGTTACAAAGAGCAGAGATGG + Intergenic
1054957195 9:70925867-70925889 ATGTTTACAATGAGAAAACAAGG + Intronic
1055403757 9:75952395-75952417 GTGGAAACAAAAAGCAAACAAGG - Intronic
1055784762 9:79861166-79861188 ATGGGTGCAGCGAACAAACATGG - Intergenic
1057417968 9:94882238-94882260 ATGGGTAAAGAGAGGAAACAGGG + Intronic
1057703227 9:97378719-97378741 ATGTGTACAAAGAGCTAATGTGG - Intergenic
1057956125 9:99409441-99409463 GTGGCTACAAAGAGAGAACATGG - Intergenic
1059037893 9:110778460-110778482 ATGTATAGAAAGAGCAAAGATGG - Intronic
1059659275 9:116385502-116385524 ATGGGAACAGAGAGCCAAAATGG - Intronic
1059690962 9:116686149-116686171 ATGGGGAGAAAGAGTAAACAAGG + Intronic
1060289958 9:122292761-122292783 AGGGGTACAAAGTGGACACAAGG + Intronic
1062203576 9:135322079-135322101 AGGGGTACAAAAAGAAGACAGGG + Intergenic
1062570805 9:137184357-137184379 ATGCAGACAAAGAGCAGACACGG + Intronic
1187029619 X:15472240-15472262 AAAGGTACAAAGAGAAAAAAAGG + Intronic
1189218374 X:39346931-39346953 ATGGATACCAAAAGCAAGCAGGG + Intergenic
1190342211 X:49306133-49306155 ATGGTTAGAAAAAGCAAAAAAGG + Intronic
1193281531 X:79656285-79656307 AAAGGTGCAAAGAGCACACAAGG - Intergenic
1194792364 X:98166548-98166570 ATGGGTTCAAAGAGAAACAATGG + Intergenic
1195459076 X:105103341-105103363 ATGGGAAACCAGAGCAAACAGGG - Intronic
1198254148 X:134910739-134910761 ATGGTTAAAAACAGCAAATATGG + Intronic
1198617511 X:138475564-138475586 AAGGGCAAAAAGAGCAAAAAGGG - Intergenic
1199392723 X:147299620-147299642 AAGAGTAGAAAGAGGAAACATGG - Intergenic
1199531141 X:148849139-148849161 ATGGGTACCAAGATCTAAAATGG + Intronic
1199810450 X:151343721-151343743 GTGTGTACAAAGAGGAGACATGG - Intergenic
1200426477 Y:3026925-3026947 ATGGGTACAACAAACCAACATGG - Intergenic
1201373788 Y:13294328-13294350 AAGGGTACCAAGAATAAACATGG + Intronic