ID: 923470073

View in Genome Browser
Species Human (GRCh38)
Location 1:234282504-234282526
Sequence ACTTTTACTTAGCCTTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 383}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923470063_923470073 20 Left 923470063 1:234282461-234282483 CCCTTGCTGTCTAACCAGGCTGC 0: 1
1: 0
2: 0
3: 10
4: 154
Right 923470073 1:234282504-234282526 ACTTTTACTTAGCCTTGCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 383
923470061_923470073 24 Left 923470061 1:234282457-234282479 CCTTCCCTTGCTGTCTAACCAGG 0: 1
1: 0
2: 1
3: 21
4: 245
Right 923470073 1:234282504-234282526 ACTTTTACTTAGCCTTGCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 383
923470066_923470073 6 Left 923470066 1:234282475-234282497 CCAGGCTGCCTATCCTGGAACCC 0: 1
1: 0
2: 0
3: 38
4: 225
Right 923470073 1:234282504-234282526 ACTTTTACTTAGCCTTGCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 383
923470067_923470073 -2 Left 923470067 1:234282483-234282505 CCTATCCTGGAACCCAGCTGAAC 0: 1
1: 0
2: 2
3: 11
4: 161
Right 923470073 1:234282504-234282526 ACTTTTACTTAGCCTTGCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 383
923470068_923470073 -7 Left 923470068 1:234282488-234282510 CCTGGAACCCAGCTGAACTTTTA 0: 1
1: 0
2: 0
3: 13
4: 176
Right 923470073 1:234282504-234282526 ACTTTTACTTAGCCTTGCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 383
923470064_923470073 19 Left 923470064 1:234282462-234282484 CCTTGCTGTCTAACCAGGCTGCC No data
Right 923470073 1:234282504-234282526 ACTTTTACTTAGCCTTGCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923470073 Original CRISPR ACTTTTACTTAGCCTTGCTG GGG Intronic
905572937 1:39020477-39020499 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
906354435 1:45092161-45092183 TCTTTTACTTAGCCTTTATGAGG + Intronic
906886042 1:49650329-49650351 ACTCTCACTTACCCTTTCTGTGG - Intronic
906934495 1:50200569-50200591 ACTGTTACAGAGCCTTGCTCTGG + Intronic
908298952 1:62742468-62742490 CCTTTTGCTTAGTCTTGCTATGG - Intergenic
908614119 1:65898504-65898526 ATTTTTGCTTAGTCTTGCTTTGG - Intronic
908964289 1:69739271-69739293 AGTTTTTCCTGGCCTTGCTGGGG + Intronic
909212443 1:72841692-72841714 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
909699006 1:78499532-78499554 ACTTTGAATTAGCTCTGCTGAGG + Intronic
909978834 1:82073915-82073937 ACATTCAGCTAGCCTTGCTGAGG - Intergenic
910315980 1:85884415-85884437 TGTTTTATTTAGCCTTTCTGAGG + Intronic
911127935 1:94358667-94358689 ACTATTAGTTAGCGTTGTTGAGG - Intergenic
911322340 1:96430118-96430140 CCTTTTGCTTAGTCTTGCTTTGG + Intergenic
911743632 1:101415254-101415276 CCTTTTGATTAGCCTTGCTATGG - Intergenic
911847274 1:102770173-102770195 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
911962307 1:104320961-104320983 CCTTTTGCTTAGTCTTGCTTTGG + Intergenic
916018258 1:160769786-160769808 AGTTTTATTTAGTCTTACTGAGG - Intergenic
916216321 1:162398048-162398070 TTTTATGCTTAGCCTTGCTGGGG + Intronic
916837739 1:168565614-168565636 ACTCTCACTGAGCCTTGCTAAGG + Intergenic
917053812 1:170956268-170956290 CTTTTTGCTTAGCCTTGCTTTGG + Intronic
917643270 1:177004518-177004540 ATTTTTACTTAGGATTGCTTTGG - Intronic
917715606 1:177734257-177734279 TCTTGAACTTTGCCTTGCTGAGG + Intergenic
918721398 1:187856904-187856926 TTTTTTGCTTAGCCTTGCTTTGG + Intergenic
921409579 1:214821123-214821145 CTTTTTGCTTAGTCTTGCTGTGG + Intergenic
922395600 1:225197493-225197515 ATTTTTGCTTAGTCTTGCTTTGG + Intronic
922995562 1:229956102-229956124 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
923470073 1:234282504-234282526 ACTTTTACTTAGCCTTGCTGGGG + Intronic
923945238 1:238878844-238878866 CCTTTTGCTTAGTCTTGCTTTGG - Intergenic
923977336 1:239278000-239278022 AATTTTACTTAGCTTCCCTGAGG - Intergenic
1064116512 10:12582339-12582361 CCTTTTTCTTAGTCTTGCTTTGG + Intronic
1064288943 10:14015545-14015567 ACTCCTGCTTATCCTTGCTGTGG + Intronic
1064938944 10:20711752-20711774 ACTTCTACCATGCCTTGCTGTGG + Intergenic
1065470578 10:26076947-26076969 CCTTTTGCTTAGTCTTGCTTTGG + Intronic
1067121006 10:43472088-43472110 ACTTGTACTTTGTCTGGCTGAGG + Intronic
1067383000 10:45792632-45792654 TGATTTAGTTAGCCTTGCTGGGG + Exonic
1067890702 10:50133177-50133199 TGATTTAGTTAGCCTTGCTGGGG + Intronic
1068011200 10:51454284-51454306 GATTTTGCTTAGCCTTGCTTTGG - Intronic
1068606639 10:59012159-59012181 AATTTTATTTAGCCTTCTTGAGG + Intergenic
1071485052 10:86094884-86094906 CCTTTTGCTTAGTCTTGCTTTGG - Intronic
1071732744 10:88265285-88265307 TCTTTTGCTTAGTCTTGCTTTGG + Intergenic
1072768856 10:98119386-98119408 TCTTTTTCTTAGTCTTGCTTTGG + Intergenic
1072815284 10:98502236-98502258 CTTTTTGCTTAGTCTTGCTGTGG - Intronic
1072885707 10:99271684-99271706 CTTTTTGCTTAGCCTTGCTTTGG - Intergenic
1073741997 10:106417837-106417859 CTTTTTACTTAGTCTTGCTTTGG - Intergenic
1073820584 10:107258779-107258801 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1074665146 10:115714020-115714042 ACTATTTCTAAGCTTTGCTGAGG - Intronic
1076249676 10:128975845-128975867 ACTTGTACATAGCATTTCTGCGG + Intergenic
1076622200 10:131797796-131797818 AATCTGACTTAGCCCTGCTGTGG - Intergenic
1077381675 11:2244872-2244894 ACTTTTTCTTAGCATTGCGGTGG - Intergenic
1077930340 11:6724617-6724639 ATTTTTGCTTAGTCTTTCTGTGG - Intergenic
1079260924 11:18880140-18880162 ACTTTTTCATAGCCTTGATATGG - Intergenic
1080799365 11:35595450-35595472 CTTTTTACTTAGTCTTGCTTTGG + Intergenic
1081558391 11:44188948-44188970 ACTTTTACTTATCCTGCTTGTGG - Intronic
1082139994 11:48597796-48597818 ATTTTTGCTTAGCCTTGCTTTGG + Intergenic
1082865207 11:57893652-57893674 TTTTTTACTTAGTCTAGCTGAGG + Intergenic
1086299729 11:85413852-85413874 ATTTTTGCTTAGTCTTGCTTTGG + Intronic
1087092686 11:94290484-94290506 TCTTTTTCTTAGTCTTGCTTTGG - Intergenic
1087206618 11:95403069-95403091 CTTTTTACTTAGTCTTGCTTTGG + Intergenic
1087310917 11:96542160-96542182 ATTTTTACTCAGCATTGCTTTGG + Intergenic
1087649105 11:100843987-100844009 ATTTTTGCTTAGTCTTGCTTTGG - Intronic
1088206814 11:107401771-107401793 TCTTTTTCTTAGCCTTGCTTTGG - Intronic
1088346314 11:108830014-108830036 CTTTTTACTTAGTCTTGCTCTGG + Intronic
1088501021 11:110482294-110482316 ATTTTTGCTTAGCCTTGCTTTGG + Intergenic
1091100356 11:132867020-132867042 CTTTTCACTTAGACTTGCTGAGG + Intronic
1091580722 12:1787070-1787092 AGTTTTCCATATCCTTGCTGTGG + Exonic
1092303476 12:7275203-7275225 CTTTTTGCTTAGTCTTGCTGTGG + Intergenic
1095893351 12:47255707-47255729 CCTTTTGCTTAGTCTTGCTTTGG - Intergenic
1096566574 12:52487148-52487170 TCTTTTACTTTGCCTTGCTTTGG - Intergenic
1097521442 12:60675631-60675653 ATTTTTACTTAGGCTAGCTTTGG + Intergenic
1097603631 12:61725737-61725759 GCTTTTGCTTAGTCTTGCTTTGG + Intronic
1097607480 12:61773395-61773417 CCTTTTGCTTAGTCTTGCTTTGG - Intronic
1097760844 12:63462214-63462236 CTTTTTGCTTAGTCTTGCTGTGG - Intergenic
1097864880 12:64551609-64551631 TCTACTACTTAGCATTGCTGTGG + Intergenic
1097916708 12:65028316-65028338 CCTTTTGCTTAGCATTGCTTTGG + Intergenic
1098072367 12:66689513-66689535 ATTTTTACCTAGCTTTACTGAGG + Intronic
1098300630 12:69050574-69050596 CCTTTTGCTTAGTCTTGCTTTGG - Intergenic
1099042336 12:77671452-77671474 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1099058748 12:77879029-77879051 ATTTTTACTGACCCTTGCAGAGG + Intronic
1099228605 12:79997395-79997417 ATTTTTATTTGGACTTGCTGGGG - Intergenic
1099472630 12:83070137-83070159 CTTTTTACTTAGTCTTGCTTTGG + Intronic
1099571458 12:84324560-84324582 TGTTTTACTTAGCCTTGTTTTGG + Intergenic
1099576022 12:84382712-84382734 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
1100696866 12:97103720-97103742 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1101534367 12:105604000-105604022 ACTCTTCCTTACCCTTGTTGTGG + Intergenic
1102404947 12:112665039-112665061 ACTATGACTTAACCTTGCTGGGG - Intronic
1102435012 12:112915571-112915593 CTTTTTACTTAGTCTTGCTTTGG + Intronic
1104332932 12:127864542-127864564 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1104524504 12:129506397-129506419 ATTTTTGCTTAGTCTTGCTTTGG - Intronic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1106335707 13:28781007-28781029 TCTTTTGCTTAGCCTTGCTTTGG + Intergenic
1106377895 13:29206860-29206882 CTTTTTGCTTAGCCTTGCTTTGG + Intronic
1106391875 13:29342102-29342124 CTTTTTGCTTAGCCTTGCTTTGG + Intronic
1108469086 13:50750387-50750409 CCTTTTGCTTAGTCTTGCTTTGG + Intronic
1109200680 13:59427392-59427414 CTTTTTGCTTAGCCTTGCTTTGG - Intergenic
1109251949 13:60030925-60030947 ACTTCTACTTAGCCCTGCAGAGG + Intronic
1109385047 13:61617720-61617742 ACTTCCACATAGCCTTGGTGGGG + Intergenic
1110363739 13:74658671-74658693 CCTTTTGCTTAGTCTTGCTTTGG - Intergenic
1110476034 13:75915026-75915048 ATTGTTAATTAGCCTTACTGTGG + Intergenic
1110604915 13:77420781-77420803 ATTTTTGCTTAGCCTTGCTTTGG + Intergenic
1111158416 13:84359430-84359452 ACATTTATTGAGCCTTACTGTGG + Intergenic
1111166539 13:84464528-84464550 CCTTTTAGTTATTCTTGCTGTGG - Intergenic
1111193064 13:84834361-84834383 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1111326641 13:86705891-86705913 ATTTTTGCTTATCCTTGCTTTGG - Intergenic
1111492683 13:89003178-89003200 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1111781559 13:92732971-92732993 GATTTTACTTAACCTTCCTGTGG + Intronic
1112747693 13:102545709-102545731 CCTTTTACTTAGTCTTGCTTTGG - Intergenic
1112897432 13:104317260-104317282 ACTATTACTTTGACATGCTGGGG + Intergenic
1115130131 14:30044930-30044952 CTTTTTACTTAGTCTTGCTTTGG - Intronic
1115502421 14:34061120-34061142 ACTTTTTCAAAGCCTTGCTCAGG + Intronic
1115937746 14:38573735-38573757 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
1115970244 14:38937367-38937389 TCTTTTGCTTAGCCTTGCTTTGG - Intergenic
1116109627 14:40560960-40560982 GCTTTTGCTTAGCCTTGCTTTGG + Intergenic
1116205362 14:41858541-41858563 ACTTTTCCTCAGCCTTGCATGGG + Intronic
1117655068 14:57946931-57946953 TTTTTTGCTTAGCCTTGCTTTGG + Intronic
1118139796 14:63067789-63067811 ATTTTTGCTTAGTCTTGCTTTGG + Intronic
1119743873 14:77030633-77030655 ACGCTTACTTAGACTTGCCGTGG + Intergenic
1126283963 15:46989505-46989527 TCTTTTTATTAGCCTTGCTGTGG - Intergenic
1126988304 15:54340738-54340760 CCTTTTGCTTAGTCTTGCTTTGG + Intronic
1127543489 15:59966815-59966837 ACATTTATTTAGGCTTGTTGTGG + Intergenic
1128415447 15:67441425-67441447 CTTTTTGCTTAGCCTTGCTTTGG - Intronic
1129046686 15:72741431-72741453 CTTTTTACTTAGTCTTGCTTTGG - Intergenic
1130852422 15:87807755-87807777 CCTTTTGCTTAGTCTTGCTTTGG + Intergenic
1131236123 15:90698604-90698626 TCTTTTGCTAATCCTTGCTGAGG - Intergenic
1132254130 15:100360264-100360286 ACATTTGCTTAGTCTTGCTTGGG - Intergenic
1135132574 16:19864871-19864893 ACTCCAACTTAGCCTTTCTGTGG + Intronic
1135852661 16:25978798-25978820 ACTTTGCCTGAGCCTTGCTATGG - Intronic
1136467882 16:30457614-30457636 ACTTTCACATACCCATGCTGTGG - Intergenic
1138403765 16:56771395-56771417 ACTTTTCTTATGCCTTGCTGAGG + Intronic
1138403865 16:56772388-56772410 ACTTTTCTTATGCCTTGCTGAGG + Intronic
1142799290 17:2335503-2335525 ACTCTAACCTGGCCTTGCTGAGG + Exonic
1143132558 17:4688886-4688908 CTTTTTGCTTAGCCTTGCTTTGG - Intronic
1144376024 17:14642644-14642666 CCTTTTGCTTAGTCTTGCTTTGG - Intergenic
1147462759 17:40584545-40584567 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
1148726175 17:49792004-49792026 ACTCTGGCTTAGCCTGGCTGAGG - Exonic
1150089229 17:62306784-62306806 ATTTTTGCTTAGCCTTGCTTTGG + Intergenic
1150093022 17:62346383-62346405 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1151406870 17:73893506-73893528 ACATTTGCTGAGCCTGGCTGGGG + Intergenic
1153168543 18:2289364-2289386 ATTTTTACTTAGTCTTGCTTTGG + Intergenic
1153573792 18:6500417-6500439 ACTTTTGCTTAGGATTGCTGTGG + Intergenic
1154090369 18:11353771-11353793 TCTTTTGCTTAGTCTTGCTTTGG - Intergenic
1155708355 18:28844723-28844745 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1156534512 18:37849694-37849716 CCTTTTACTTGGCCTTTCTATGG + Intergenic
1156837500 18:41572085-41572107 TCTTTTACTTATCCTTATTGAGG - Intergenic
1157541342 18:48512453-48512475 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1158331284 18:56365796-56365818 CTTTTTACTTAGTCTTGCTTTGG + Intergenic
1158656724 18:59343339-59343361 CCTTTTGCTTAGCATTGCTTTGG - Intronic
1158830211 18:61268939-61268961 CCTTTTCCTTAGTCTTGCTTTGG - Intergenic
1160293458 18:77616699-77616721 AGCTTGAATTAGCCTTGCTGGGG - Intergenic
1163445342 19:17342590-17342612 AATTTTCCTTAGCCCTTCTGTGG + Intronic
1164442064 19:28286337-28286359 GTTTTTACTTAGTCTTGCTTTGG + Intergenic
1165600833 19:37054884-37054906 GCTCTAACTTAGGCTTGCTGAGG - Intronic
1166630772 19:44405405-44405427 CTTTTTACTTAGTCTTGCTTTGG - Intergenic
1166805784 19:45486047-45486069 GCTCTTACTTAGCTTTGATGTGG + Exonic
927217807 2:20678795-20678817 ACTTTTTCTTAGCTTGGCTTGGG + Intergenic
927722470 2:25393934-25393956 CTTTTTGCTTAGTCTTGCTGTGG - Intronic
928297862 2:30100890-30100912 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
928442854 2:31307002-31307024 CTTTTTGCTTAGTCTTGCTGTGG + Intergenic
929036949 2:37702668-37702690 CCTTTTGCTTAGTCTTGCTTTGG + Intronic
929370331 2:41215840-41215862 ATTGTTACTTAGTCTTGCTTAGG + Intergenic
929600196 2:43199917-43199939 ATTTGTAAATAGCCTTGCTGAGG + Intergenic
930143002 2:47972414-47972436 TCTTTTTCTTAGTCTTGCTTTGG - Intergenic
930159644 2:48141601-48141623 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
930985784 2:57586346-57586368 ACTTTTATTCAGCATTGCCGTGG - Intergenic
931869538 2:66443929-66443951 ACTTTTATTTGGAATTGCTGTGG + Intronic
932851414 2:75191313-75191335 TCCTTTACTTGTCCTTGCTGAGG - Intronic
933194966 2:79378668-79378690 ACTTTTACTTAGAGGTGCTTGGG + Intronic
935104320 2:100025587-100025609 CTTTTTACTTAGTCTTGCTTTGG - Intronic
935175426 2:100644580-100644602 AGTTTTAGAAAGCCTTGCTGGGG + Intergenic
937053177 2:118908738-118908760 ACTTTTTCTGAGCAGTGCTGAGG - Intergenic
938542895 2:132300289-132300311 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
939386635 2:141508490-141508512 ACTTACACTTAGCCTAGCTAGGG + Intronic
939767702 2:146272733-146272755 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
939946059 2:148412410-148412432 CCTTTTACTTAGGATTGCTTTGG + Intronic
940157176 2:150669978-150670000 CCTTTCACTTAGTCTTGCTTTGG - Intergenic
940762785 2:157755853-157755875 CCTTTTGCTTAGTCTTGCTTTGG - Intronic
941401642 2:165038649-165038671 TCTTTTGCTTAGTCTTGCTTTGG + Intergenic
942815432 2:180047908-180047930 TCTTTTGCTTAGTCTTGCTTTGG - Intergenic
943221261 2:185109376-185109398 CTTTTTACTTAGAATTGCTGTGG - Intergenic
944036631 2:195302335-195302357 ACTTTTACTAAGCCATGCTGTGG - Intergenic
945131630 2:206579680-206579702 TCTTTTGCTTAGTCTTGCTTTGG + Intronic
946053326 2:216881473-216881495 AGTTTTACAAAGCCTTGGTGTGG + Intergenic
947185570 2:227452320-227452342 TCTTTAACTTAGCCTGGCTTAGG + Intergenic
947475151 2:230439249-230439271 ATTTTTGCTTAGTCTTGCTTTGG + Intronic
948359078 2:237405637-237405659 ACAATCACTTTGCCTTGCTGGGG - Intronic
948718925 2:239883861-239883883 ACTTTTGCTTAGCATTGCAGTGG - Intergenic
1169479858 20:5969798-5969820 GCTCTAACTTAGCGTTGCTGGGG + Intronic
1170489104 20:16853207-16853229 TCTTTTTCTTAGTCTTGCTTTGG + Intergenic
1171286226 20:23940325-23940347 TCTTTTGCTTAGACTTGCTCTGG - Intergenic
1171756676 20:29116595-29116617 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1174061438 20:47835686-47835708 ACTTGGACTTAACCTTGCTCAGG + Intergenic
1174070088 20:47893637-47893659 ACTTGGACTTAACCTTGCTTAGG - Intergenic
1174101232 20:48127541-48127563 ACTTGGACTTAACCTTGCTTAGG + Intergenic
1174156305 20:48517588-48517610 ACTTGGACTTAACCTTGCTTAGG + Intergenic
1175000059 20:55617853-55617875 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1175075378 20:56367896-56367918 AATTTTATTTAGCCTTGTGGAGG - Exonic
1176898416 21:14411144-14411166 ATTTTTACTTAGGATTGCTTTGG + Intergenic
1177069192 21:16481468-16481490 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1177364184 21:20112871-20112893 CTTTTTACTTAGTCTTGCTTTGG + Intergenic
1177579196 21:22997404-22997426 CTTTTTGCTTAGCCTTGCTTTGG - Intergenic
1180413730 22:12640439-12640461 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1180627024 22:17200413-17200435 ACATTAACTTTGCCTTGCAGTGG - Intronic
1181373239 22:22435014-22435036 CCTTTTGCTTAGTCTTGCTTTGG + Intergenic
1183298301 22:37045027-37045049 TCTGTTACTTATCCTTGATGTGG - Intergenic
1183428095 22:37750403-37750425 GTTTTTCCTGAGCCTTGCTGTGG + Intronic
949689095 3:6614088-6614110 ACTTGGACTTGGCCTTGTTGGGG - Intergenic
950233691 3:11299088-11299110 CCCATTACTTAGCATTGCTGTGG + Intronic
950592011 3:13943629-13943651 CTTTTTACTTAGTCTTGCTTTGG + Intronic
951353662 3:21637560-21637582 ATTTTTGCTTAGTCTTGCTTTGG + Intronic
951468178 3:23025036-23025058 CTTTTTACTTAGTCTTGCTTTGG - Intergenic
951859205 3:27232601-27232623 CTTTTTGCTTAGCCTTGCTTTGG - Intronic
952014134 3:28937103-28937125 ACTTTTTCTTAGTATTGCTCTGG - Intergenic
955046775 3:55368376-55368398 ACTTCGACTTGGCCTAGCTGAGG + Intergenic
955165417 3:56506368-56506390 TCTTTTTCTTAGCCTGGCTAAGG - Intergenic
955175254 3:56607094-56607116 CTTTTTGCTTAGTCTTGCTGTGG + Intronic
956995276 3:74820079-74820101 ATTTTTGCTTAGACTTGCTTTGG + Intergenic
957331610 3:78771348-78771370 CCTTTTGCTTAGCATTGCTTTGG + Intronic
957772466 3:84712101-84712123 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
958093309 3:88905199-88905221 GCTTTTGCTTAGTCTTGCTTTGG + Intergenic
958587110 3:96101976-96101998 ATTTTTACTTAGTATTGCTTTGG + Intergenic
958775276 3:98475155-98475177 CCTTTTGCTTAGTCTTGCTTTGG + Intergenic
959824789 3:110780913-110780935 ACTTCAACTTAGCTTTTCTGTGG + Intergenic
960481341 3:118194181-118194203 TCTTTTACTTAGTCTAGCTAAGG + Intergenic
960711987 3:120539706-120539728 ATTTTTACTTAGTCTGGCTTTGG + Intergenic
960808512 3:121606972-121606994 ACTTTTAGATAGGCTTGGTGTGG + Intronic
961407209 3:126688699-126688721 CCTTTTGCTTAGTCTTGCTTTGG + Intergenic
962502988 3:136014269-136014291 TCTTTTGCTTAGTCTTGCTTTGG + Intronic
962662436 3:137616975-137616997 ACACTTACTGAGCCTTTCTGGGG - Intergenic
963113262 3:141704028-141704050 CTTTTTGCTTAGCCTTGCTTTGG - Intergenic
964252816 3:154739317-154739339 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
964393988 3:156226105-156226127 CCTTTTGCTTAGTCTTGCTTTGG - Intronic
964666787 3:159183141-159183163 ACTTTGACTTTGCCCTGCAGTGG - Intronic
966000567 3:174944038-174944060 ACTTTTCCTTAGGGCTGCTGCGG + Intronic
969947277 4:10797328-10797350 CCTTTTGCTTAGTCTTGCTTTGG - Intergenic
970605596 4:17678717-17678739 CTTTTTGCTTAGCCTTGCTTTGG - Intronic
970769857 4:19598684-19598706 AAATATACTCAGCCTTGCTGTGG + Intergenic
971509647 4:27408077-27408099 TATTTTACTTATCCTAGCTGAGG + Intergenic
971554617 4:27997883-27997905 CCTTTTGCTTAGTCTTGCTATGG + Intergenic
972269637 4:37498356-37498378 ATTTTTGCTTAGTCTTGCTTTGG + Intronic
972428487 4:38957634-38957656 ACTTTTTCTTATCATTGCTTGGG + Intergenic
973062192 4:45741342-45741364 ACTGTTAATTAGCCATTCTGAGG - Intergenic
973179211 4:47247472-47247494 ATTTTTGCTTAGTCTTGCTTTGG + Intronic
973342650 4:49021503-49021525 ATTTTTACTTAGTCTTGCTTTGG + Intronic
974249139 4:59362350-59362372 ACTTTTCCTTAGGGTTGCAGGGG + Intergenic
974993073 4:69117245-69117267 TCTTTTTCTTAGTCTTGCTTTGG + Intronic
975185182 4:71393703-71393725 CTTTTTACTTAGCCTTGCTTTGG - Intronic
975969718 4:80018886-80018908 ACTTTTACTTACACATTCTGTGG + Exonic
976492588 4:85689000-85689022 ACTTTTGCTTAGGATTGCTTTGG + Intronic
977444962 4:97119444-97119466 TCTTTTGCTTAGTCTTGCTTTGG - Intergenic
977502617 4:97860179-97860201 CCTTTTTCTTAGCCTTGTTTTGG + Intronic
978111844 4:104974222-104974244 GCTTTTACTATGCCTTGTTGAGG - Intergenic
978201280 4:106026072-106026094 CTTTTTACTTAGCCTTGCTTTGG + Intergenic
979201230 4:117981211-117981233 ATTTTTGCTTAGACTTGCTTTGG - Intergenic
979813769 4:125072806-125072828 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
979984848 4:127301071-127301093 CTTTTTGCTTAGCCTTGCTTTGG - Intergenic
981042574 4:140237007-140237029 ACATCTACTTAGTCTTTCTGTGG - Intergenic
982075671 4:151734622-151734644 CCTTTTGCTTAGTCTTGCTTTGG - Intronic
982528077 4:156504960-156504982 CTTTTTACTTAGTCTTGCTTTGG - Intergenic
982830134 4:160049049-160049071 CTTTTTGCTTAGCCTTGCTTTGG - Intergenic
983949569 4:173623070-173623092 TCTTTTGCTTAGCATTGCTTTGG + Intergenic
984066887 4:175059310-175059332 CTTTTTGCTTAGCCTTGCTTTGG - Intergenic
984246156 4:177277300-177277322 GCTTTCACTTAGCTTTCCTGCGG + Intergenic
984404539 4:179310535-179310557 CCTTTTGCTTAGCATTGCTTTGG + Intergenic
984527169 4:180871244-180871266 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
986047719 5:4056164-4056186 ATTTTTTCTTAGTCTTGCTTTGG + Intergenic
986227788 5:5832765-5832787 CCTTTTGCTTAGTCTTGCTTTGG - Intergenic
987796196 5:22630301-22630323 CCTTTTACTTAGGATTGCTTTGG - Intronic
989721356 5:44532405-44532427 TATTTTGCTTAGCCTTGCTTTGG + Intergenic
989727847 5:44608516-44608538 CTTTTTCCTTAGCCTTGCTTTGG - Intergenic
990604468 5:57395072-57395094 ACTTGTTCTCAGCCTTTCTGGGG + Intergenic
990891371 5:60654057-60654079 CTTTTTGCTTAGCCTTGCTTTGG + Intronic
991106290 5:62846104-62846126 ACTTTTACTCAGGGTTGCTTTGG + Intergenic
992520714 5:77547821-77547843 CTTTTTGCTTAGCCTTGCTTTGG - Intronic
992599475 5:78383884-78383906 CTTTTTACTTAGTCTTGCTTTGG + Intronic
994111522 5:96010245-96010267 TCTTTTACTTAGGATTGCTTTGG + Intergenic
994222026 5:97207368-97207390 ACTTTTACTTAATCTTGCTTTGG + Intergenic
994270930 5:97775690-97775712 ACTTTTGCTTAGGATTGCTTTGG - Intergenic
994358330 5:98821008-98821030 CTTTTTGCTTAGCCTTGCTTTGG - Intergenic
994425817 5:99585994-99586016 ACTTTGACATATCCTTTCTGAGG - Intergenic
994645369 5:102462425-102462447 ATTTTTACTTAGTCTTGCTTTGG - Intronic
994659328 5:102634916-102634938 ATTTTTGCTTAGTCTTGCTTGGG - Intergenic
994896964 5:105718984-105719006 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
994925029 5:106104613-106104635 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
996198200 5:120636316-120636338 TCTTTTTCTTAGTCTTGCTTTGG - Intronic
996284963 5:121779062-121779084 CTTTTTGCTTAGCCTTGCTTTGG - Intergenic
996490952 5:124095547-124095569 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
996694631 5:126380358-126380380 CCTTTTGCTTAGTCTTGCTTTGG + Intronic
997780294 5:136651129-136651151 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
998242373 5:140459205-140459227 GCTCTTACTTTGGCTTGCTGTGG + Exonic
998509301 5:142698018-142698040 GCTTGTCCTTAGCCTTTCTGTGG - Exonic
998597514 5:143548451-143548473 ACTTTTTTTCAGCCTTACTGAGG + Intergenic
998603513 5:143609434-143609456 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
998776951 5:145614271-145614293 CCTTTTGCTTAGTCTTGCTTTGG + Intronic
999213539 5:149912298-149912320 ACTTTTATTTTGCCTTCCTTTGG + Intronic
1000024952 5:157350577-157350599 CCTTTTGCTTAGCCTTGCTTTGG + Intronic
1000510821 5:162180323-162180345 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
1000511240 5:162185986-162186008 TTTTTTACTTAGTCTTGCTTTGG + Intergenic
1001176791 5:169476779-169476801 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1003711037 6:8590497-8590519 ACTCTGACATAGACTTGCTGCGG + Intergenic
1005371990 6:25143292-25143314 AATATTAGTTAGCCTAGCTGTGG - Intergenic
1007893102 6:45314826-45314848 CTTTTTGCTTAGCCTTGCTTTGG - Intronic
1008545910 6:52583121-52583143 ACTTTTTCTCAGCCTCTCTGAGG - Intergenic
1008835797 6:55827183-55827205 CCTTTTACTGAGATTTGCTGTGG - Intronic
1008973190 6:57394113-57394135 CTTTTTGCTTAGCCTTGCTTTGG + Intronic
1009162095 6:60295652-60295674 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
1009969398 6:70610875-70610897 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1011365681 6:86579318-86579340 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1011373093 6:86661052-86661074 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
1012027931 6:94021506-94021528 CCTTTTGCTTAGTCTTGCTTTGG + Intergenic
1012361573 6:98388923-98388945 CCTTTTGCTTAGACTTGCTTTGG + Intergenic
1012424914 6:99103249-99103271 TCTGTTACTCAGCCTTGTTGAGG - Intergenic
1013711231 6:112901934-112901956 AGTTTTACTTTGACATGCTGAGG - Intergenic
1013940673 6:115657692-115657714 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1014792345 6:125687801-125687823 TCTTTTGCTTAGTCTTGCTTTGG + Intergenic
1015900229 6:138057640-138057662 TCTTTTGCTTAGTCTTGCTTTGG - Intergenic
1016631010 6:146231375-146231397 AATTTGACTTGGCATTGCTGTGG - Intronic
1017374544 6:153753021-153753043 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
1018356772 6:163026028-163026050 CCTTTTACTTAGATTTGCTTTGG - Intronic
1021578026 7:22122593-22122615 ACATTTACTCAGCCTTAGTGTGG - Intronic
1023692896 7:42810404-42810426 CTTTTTACTTAGTCTTGCTTTGG - Intergenic
1023904088 7:44508848-44508870 GCTTTTACTCAGCCTTGCTCTGG + Intergenic
1023922500 7:44640386-44640408 ACTTTTACTGAGGCTCTCTGTGG - Intronic
1024000447 7:45185839-45185861 ACATTTACTCAGCCTTGATCAGG + Intronic
1024019070 7:45348860-45348882 ACTTTTCCTTAACCTCGCTTTGG - Intergenic
1024668914 7:51573260-51573282 CTTTTTACTTAGTCTTGCTTTGG + Intergenic
1024875825 7:54022037-54022059 CCTTTTGCTTAGTCTTGCTTTGG + Intergenic
1025773276 7:64533706-64533728 TCTTTTGCTTAGTCTTGCTTTGG - Intronic
1025820921 7:64962773-64962795 TCTTTTGCTTAGTCTTGCTTTGG - Intergenic
1026615689 7:71901457-71901479 CCTTTTACTTAGAATTGCTTTGG - Intronic
1027699604 7:81453448-81453470 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1028262040 7:88678512-88678534 AATTTTGCTTAGTCTTGCTTTGG - Intergenic
1028502253 7:91532165-91532187 CTTTTTACTTAGTCTTGCTTTGG - Intergenic
1028703217 7:93807934-93807956 CTTTTTACTTAGTCTTGCTTTGG - Intronic
1028893105 7:96010483-96010505 GCTTTTCCTCATCCTTGCTGTGG + Intronic
1028936497 7:96470194-96470216 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
1029532501 7:101134736-101134758 AATTTTATTCAGCCTGGCTGGGG - Intronic
1029996176 7:105010664-105010686 ACTTTTACATTGCCTACCTGTGG + Intergenic
1030936362 7:115589520-115589542 ATTTTTACTTAGTCTTGCTTTGG - Intergenic
1031209417 7:118803312-118803334 TTTTTTACTTAGCATTGCTTTGG + Intergenic
1031220021 7:118953291-118953313 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1031580478 7:123468324-123468346 AGTTTTTCTTAACCTTGCTTTGG + Intronic
1031782166 7:125981893-125981915 ATTTTTGCTTAGCATTGCTTTGG + Intergenic
1031799087 7:126220075-126220097 CTTTTTACTTAGTCTTGCTTTGG + Intergenic
1032922266 7:136562737-136562759 TCTTTTGCTTAGTCTTGCTTTGG + Intergenic
1033502307 7:141964393-141964415 ATTTTTGCTTAGTCTTGCTTTGG + Intronic
1033961205 7:146915264-146915286 ATTTTCACTTAGTCTTGCTTTGG + Intronic
1034058566 7:148064182-148064204 ATTTTTGCTTAGTCTTGCTTTGG + Intronic
1035069676 7:156133328-156133350 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1038468687 8:27791572-27791594 ACTTTTACTTAGCCTTTTCTTGG + Intronic
1038949919 8:32402952-32402974 ATTTTTCCTCAGCCTTGTTGAGG + Intronic
1039268753 8:35857311-35857333 CCTTTTGCTTAGTCTTGCTTTGG - Intergenic
1040401843 8:47058750-47058772 ACTTTTGCTTAGAATTGCTTTGG - Intergenic
1043537389 8:81220975-81220997 TCTTTTGCTTAGTCTTGCTTTGG + Intergenic
1044787872 8:95814853-95814875 GTTTTTGCTTAGCCTTGCTTTGG + Intergenic
1045878301 8:107008700-107008722 CCTTTTTCTTAGTCTTGCTTTGG - Intergenic
1046369474 8:113282773-113282795 CCTTTTGCTTAGTCTTGCTTTGG - Intronic
1046782219 8:118227823-118227845 ATTTTTGCTTAGTCTTGCTTTGG - Intronic
1047839698 8:128737905-128737927 ACTTTTATTTTGCCTGGCTGTGG + Intergenic
1047884171 8:129230130-129230152 ACTTTTTCTTAGATCTGCTGTGG - Intergenic
1047890079 8:129298702-129298724 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1048045153 8:130766139-130766161 AGTTGTACTCAGCCTGGCTGGGG + Intergenic
1048915677 8:139180894-139180916 ATTTTTGCTTAGCATTGCTTTGG - Intergenic
1050952077 9:11610234-11610256 ACTTTGTCTTAGTCTTGCTTGGG - Intergenic
1051190274 9:14504279-14504301 CCTTTTGCTTAGTCTTGCTTTGG + Intergenic
1051754826 9:20387805-20387827 ACCTTTAGATAGCCTTCCTGTGG - Intronic
1052708666 9:32024558-32024580 CCTTTTGCTTAGACTTGCTTTGG + Intergenic
1055656769 9:78458277-78458299 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1055919801 9:81447736-81447758 CTTTTTGCTTAGCCTTGCTTTGG + Intergenic
1058028517 9:100169451-100169473 TCATTTACTTGGCCTTGCAGAGG - Intronic
1058156344 9:101520163-101520185 CTTTTTACTTAGTCTTGCTTTGG + Intronic
1058410844 9:104729642-104729664 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1059662327 9:116414461-116414483 ACTGTCACTTGGCCTTGCTTGGG - Intergenic
1187218777 X:17303256-17303278 CTTTTTCCTTAGCCTTGCTTTGG + Intergenic
1188267009 X:28089346-28089368 ATTGTTGCTTAGTCTTGCTGTGG - Intergenic
1188376859 X:29442098-29442120 CTTTTTGCTTAGCCTTGCTTTGG - Intronic
1189218544 X:39349316-39349338 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1190212271 X:48458501-48458523 TCTTTCTCTTAGTCTTGCTGGGG - Intergenic
1191692468 X:63954759-63954781 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1191812634 X:65206201-65206223 CTTTTTACTTAGTCTTGCTTTGG - Intergenic
1192014097 X:67310091-67310113 CTTTTTACTTAGTCTTGCTTTGG + Intergenic
1192031605 X:67519361-67519383 TCTTTTACTTAGCCTTTCTTTGG + Intergenic
1192095512 X:68206671-68206693 ACTTTTACTTGTCCTTGTAGGGG - Exonic
1192343751 X:70284334-70284356 CCTTTTTCCTAGCTTTGCTGGGG + Intronic
1192563668 X:72144787-72144809 GCTTTCAATTAACCTTGCTGGGG + Intergenic
1193390740 X:80925687-80925709 TCTTTTGCTTAGTCTTGCTTTGG - Intergenic
1193493363 X:82178675-82178697 TCTTTTACTTAGGATTGCTTTGG + Intergenic
1193498664 X:82244391-82244413 CCTTTTGCTTAGCATTGCTTTGG - Intergenic
1193649651 X:84114647-84114669 AATTTTACTTAGGGTTGCTTTGG - Intronic
1193674283 X:84429739-84429761 ACTTTTACTTGACCTTAGTGGGG + Intronic
1193690773 X:84639534-84639556 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1193731720 X:85110163-85110185 ACTTTTACGAAGCCTTGGGGAGG - Intergenic
1193775620 X:85637631-85637653 CTTTTTACTTAGTCTTGCTTTGG + Intergenic
1193791997 X:85826115-85826137 CTTTTTACTTAGTCTTGCTTTGG - Intergenic
1194125916 X:90016502-90016524 ATTTTCACTTAGTCTTGCTTTGG - Intergenic
1194227778 X:91282483-91282505 ACCTTTACTTGGCATTCCTGAGG + Intergenic
1194278564 X:91917865-91917887 ATTTTTGCTTAGTCTTGCTTTGG - Intronic
1194375598 X:93129037-93129059 ATTTTTACATAGCCTTGCTGAGG - Intergenic
1194863931 X:99041809-99041831 ATTTTTGCTTAGTCTTGCTTTGG + Intergenic
1194917931 X:99727278-99727300 CTTTTTACTTAGTCTTGCTTTGG + Intergenic
1195150040 X:102058038-102058060 TCTTTTGCTTAGTCTTGCTTTGG + Intergenic
1195913026 X:109907892-109907914 ATTTTTGCTTACCCTTGCTTTGG + Intergenic
1196465212 X:115965338-115965360 ATTTTTGCTTAGTCTTGCTTTGG - Intergenic
1196477322 X:116103583-116103605 TCTTTTGCTTAGACTTGCTTTGG + Intergenic
1196518994 X:116650408-116650430 TCTTTTACTTAGTCTTGCTTTGG + Intergenic
1196569069 X:117244497-117244519 ACTTTTACTTGGGCTATCTGGGG + Intergenic
1196675310 X:118414129-118414151 TCTTTTGCTTAGTCTTGCTTTGG + Intronic
1196688969 X:118538639-118538661 CCTTTTACTTAGCACTGCTCCGG + Intronic
1196783119 X:119400051-119400073 ACTTTTGCTTAGGCTGGCTTAGG + Intronic
1197079904 X:122399837-122399859 TCTTTTGCTTAGTCTTGCTTTGG - Intergenic
1197102865 X:122677202-122677224 CCTTTTGCTTAGTCTTGCTTTGG - Intergenic
1197206953 X:123798838-123798860 ACATTTACTGAGCCTTTATGGGG - Intergenic
1197977230 X:132178990-132179012 GCTTTTACTTAGGATAGCTGTGG + Intergenic
1198894658 X:141439626-141439648 CTTTTTGCTTAGTCTTGCTGTGG + Intergenic
1199914022 X:152319266-152319288 CTTTTTGCTTAGCCTTGCTTTGG - Intronic
1200595897 Y:5139938-5139960 ATTTTTGCTTAGTCTTGCTTTGG - Intronic
1201934382 Y:19391485-19391507 TCTTTGTCTTAGCCTTGCTTTGG + Intergenic