ID: 923478579

View in Genome Browser
Species Human (GRCh38)
Location 1:234360571-234360593
Sequence CTGGAGTTATGTAGAGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923478579_923478581 12 Left 923478579 1:234360571-234360593 CCATTTGCTCTACATAACTCCAG No data
Right 923478581 1:234360606-234360628 CTAAAATGAAAACATAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923478579 Original CRISPR CTGGAGTTATGTAGAGCAAA TGG (reversed) Intergenic
No off target data available for this crispr