ID: 923482682

View in Genome Browser
Species Human (GRCh38)
Location 1:234398331-234398353
Sequence AATCTAACCAGATCAACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923482679_923482682 -1 Left 923482679 1:234398309-234398331 CCTTAGTAACTTAAATCAAAAAA 0: 1
1: 0
2: 3
3: 49
4: 724
Right 923482682 1:234398331-234398353 AATCTAACCAGATCAACAAGGGG 0: 1
1: 0
2: 1
3: 12
4: 168
923482678_923482682 4 Left 923482678 1:234398304-234398326 CCTGTCCTTAGTAACTTAAATCA 0: 1
1: 0
2: 1
3: 17
4: 158
Right 923482682 1:234398331-234398353 AATCTAACCAGATCAACAAGGGG 0: 1
1: 0
2: 1
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923482682 Original CRISPR AATCTAACCAGATCAACAAG GGG Intronic
904511420 1:31012259-31012281 ACACTAACCAGAACAACAAGAGG - Intronic
905494589 1:38374951-38374973 AAAATAACCAGGTAAACAAGTGG - Intergenic
907711515 1:56886950-56886972 AATCTAACTAAATCAAAAACTGG + Intronic
914233165 1:145783375-145783397 AATCTAACAACATCAAAATGTGG + Intronic
914685532 1:149975652-149975674 AACCTAACATGATCACCAAGAGG + Intronic
916918633 1:169438780-169438802 AATGTGACCAGATAAATAAGGGG + Intronic
917577007 1:176333682-176333704 AAAATAACCCCATCAACAAGTGG - Intergenic
917696944 1:177534923-177534945 ACTCTAACAAGAACAGCAAGGGG + Intergenic
919014448 1:192013387-192013409 AATGTATCCAGAACAAAAAGAGG - Intergenic
920554316 1:206893376-206893398 AGTCTAAGGAGATCAACCAGTGG + Intergenic
921244189 1:213219170-213219192 AATGTAACCCCATCAACAAGTGG + Intronic
922649825 1:227328047-227328069 AAGCTAACCAGGTAAACTAGGGG + Intergenic
923482682 1:234398331-234398353 AATCTAACCAGATCAACAAGGGG + Intronic
923928330 1:238661887-238661909 AATATAACCAGTTCAACATAGGG - Intergenic
1063192752 10:3713062-3713084 ATTCTAACCAGCTCTACAGGAGG + Intergenic
1065392938 10:25203084-25203106 AATCAAACCCCATCAAAAAGTGG - Intronic
1072772774 10:98156157-98156179 AATCTAAGGATAACAACAAGTGG - Intronic
1072926117 10:99619205-99619227 AATGGAAAGAGATCAACAAGAGG - Intronic
1074414375 10:113254469-113254491 AATCCAACCAGATCCGCGAGGGG - Intergenic
1074414383 10:113254516-113254538 AATCCAACCAGATCCGCAAGGGG - Intergenic
1075262456 10:120975137-120975159 AATCAAAACAAAACAACAAGTGG + Intergenic
1076775185 10:132691691-132691713 AAACTAACAAGAACAACATGAGG + Intronic
1077705560 11:4482010-4482032 GATCTAAGTAGATAAACAAGAGG - Intergenic
1079373760 11:19873545-19873567 AAGCTAATCAAATCAGCAAGTGG - Intronic
1080308973 11:30867671-30867693 AATCTCACCAGAGCAACAGAGGG - Intronic
1080312421 11:30910560-30910582 AATCTATTCTGTTCAACAAGAGG + Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1084117347 11:67049994-67050016 AAACTTACCAGATCAAGAAAGGG + Exonic
1091651197 12:2311414-2311436 AAGCCAAGCAGATCAACCAGAGG + Intronic
1092856930 12:12682796-12682818 AATCTACACAGATCAAAAAAAGG + Intronic
1093541172 12:20287105-20287127 AATATCACAAGAACAACAAGGGG + Intergenic
1093675839 12:21939590-21939612 AATCTAAACAGCTCCAGAAGGGG - Intronic
1094165679 12:27440520-27440542 AATCTAACAAAAACAACAATAGG + Intergenic
1095238312 12:39825853-39825875 TAACTAAACAGATCCACAAGAGG - Intronic
1097347120 12:58505860-58505882 AATCTATCCAGTTTTACAAGCGG - Intergenic
1098265586 12:68715657-68715679 TCTCTATCCAGATCATCAAGGGG - Exonic
1099106036 12:78497505-78497527 AAAACAACCCGATCAACAAGTGG - Intergenic
1099469683 12:83032381-83032403 GATATAACCAGATTAATAAGGGG - Intronic
1100353812 12:93809910-93809932 AATCTAACCACTTCTACAAGTGG + Intronic
1102941535 12:116946812-116946834 AAGCTGCCCAGATAAACAAGGGG + Intronic
1103251457 12:119503482-119503504 GATTTAACCAGATCTTCAAGAGG - Intronic
1104529397 12:129554661-129554683 AAAATATCCAGTTCAACAAGTGG - Intronic
1108890248 13:55249335-55249357 AATGTAACCAGATAAGCAAAAGG + Intergenic
1112483982 13:99803101-99803123 AGTCTGACTAGACCAACAAGGGG + Intronic
1113164236 13:107419759-107419781 AATCTAATCACATGAACAAGTGG + Intronic
1116728531 14:48593043-48593065 AAACAAACCCCATCAACAAGTGG + Intergenic
1118531592 14:66712417-66712439 AAACCAACCCCATCAACAAGCGG - Intronic
1118847944 14:69562190-69562212 AATCTCACCTGATCCACAGGTGG - Intergenic
1120699850 14:87687120-87687142 AAGGTGACCAGATCAAAAAGAGG + Intergenic
1123956621 15:25342613-25342635 AATCTACCCGGATCAAAAAGGGG + Intronic
1124055754 15:26239343-26239365 ATTCCAACCTGGTCAACAAGAGG + Intergenic
1128017621 15:64361401-64361423 ACTCTAACCTGCTCAACAAAGGG - Intronic
1128242309 15:66109313-66109335 AATCTCATGAGGTCAACAAGGGG - Intronic
1133618552 16:7503503-7503525 CATTTAACCAAATCCACAAGGGG - Intronic
1135273782 16:21092835-21092857 AATCTAAGAAGATATACAAGAGG + Intronic
1135974319 16:27097403-27097425 AATGTAACCATATTAAGAAGTGG - Intergenic
1137095275 16:36247017-36247039 AATCAAACGAGATCATCAAATGG - Intergenic
1138724381 16:59119905-59119927 AATTTATCCTGATCAGCAAGAGG - Intergenic
1139335021 16:66225707-66225729 AATCTAACAAGATCCCCAGGGGG + Intergenic
1143937544 17:10502743-10502765 AATCAAACTTGAACAACAAGTGG - Exonic
1143939898 17:10529569-10529591 AATCAAACTTGAACAACAAGTGG - Exonic
1144154143 17:12482171-12482193 AAACTAGCCTGACCAACAAGGGG - Intergenic
1145844648 17:28028135-28028157 AATCTGAACATATCAACAACAGG + Intergenic
1145858568 17:28186670-28186692 GATCTGACCAGATTAAAAAGGGG - Intronic
1146591530 17:34131796-34131818 AATGGGACCAGATAAACAAGAGG + Intronic
1153908074 18:9681542-9681564 AATTTAACAGGATCAACCAGTGG - Intergenic
1156674077 18:39506783-39506805 AATCTAGCCAGATTAGCATGGGG - Intergenic
1161360709 19:3847997-3848019 AATCTACAGAGCTCAACAAGAGG + Intronic
1163791999 19:19312580-19312602 AACCTAAATACATCAACAAGGGG + Intronic
1163941202 19:20495761-20495783 AAACAAACCCCATCAACAAGTGG + Intergenic
1164710140 19:30350641-30350663 AATCTAATCAGATTTATAAGAGG + Intronic
1164843259 19:31410596-31410618 TCTCTAACCAGATCCACCAGTGG - Intergenic
1165024915 19:32953449-32953471 AATCTAACCAGATAGAAATGAGG + Intronic
1166616497 19:44253063-44253085 AAACTAACCCCATCAAAAAGTGG + Intronic
1168146714 19:54423637-54423659 ACTCGAACCAATTCAACAAGGGG - Intronic
1168245035 19:55108737-55108759 ACTCTAGCCTGAGCAACAAGAGG - Intronic
925800611 2:7596342-7596364 AAACTAACTAGATCACCAACTGG + Intergenic
926616256 2:14999483-14999505 ACTATCACCAGAACAACAAGGGG - Intergenic
927789670 2:26000535-26000557 AATCTAAACAGAACAACAGCTGG + Intergenic
928479081 2:31662881-31662903 ACTCCAATCAGATCACCAAGTGG - Intergenic
928573281 2:32629152-32629174 ACTCCAGCCAGAGCAACAAGAGG - Intronic
928723884 2:34149025-34149047 AATCTAGCCTGGGCAACAAGAGG + Intergenic
929772637 2:44905364-44905386 TATCCAACCATATCAGCAAGGGG - Intergenic
929812566 2:45203270-45203292 AATCTTATCAGATCAAAAGGGGG + Intergenic
930575645 2:53143733-53143755 AATAAAACCAGAGCAAAAAGTGG + Intergenic
932029693 2:68171028-68171050 AATCTAACAAAAACCACAAGGGG - Intronic
933894462 2:86798206-86798228 ACTCCAACCTGAGCAACAAGAGG - Intronic
940004786 2:149000563-149000585 AATCTAACCAGAATATCATGGGG - Intronic
942830534 2:180233832-180233854 AATCAAACCCCATCAAAAAGTGG + Intergenic
943351186 2:186798278-186798300 AACCAAACCACATCAAAAAGTGG + Intergenic
943828667 2:192429654-192429676 AAAATAACCCCATCAACAAGTGG - Intergenic
943998727 2:194805226-194805248 AAAATAACCCCATCAACAAGTGG - Intergenic
944849596 2:203704929-203704951 AATCTTAACAGACCAACAGGTGG + Intergenic
946661260 2:222002561-222002583 AAAACAACCACATCAACAAGTGG + Intergenic
946948058 2:224842997-224843019 GAACCAACCAGACCAACAAGGGG + Intronic
1170951698 20:20942452-20942474 AATCTAACAAGATGTTCAAGCGG + Intergenic
1170991346 20:21303983-21304005 AATCTAACCAGAACAACAAATGG - Intronic
1174185845 20:48705495-48705517 TATCTGATCAGATCAGCAAGAGG + Intronic
1177745394 21:25207037-25207059 AAACAAACCAGATCAACAATGGG - Intergenic
1179227611 21:39468864-39468886 AAGCTTCCCAGATGAACAAGAGG - Intronic
1179252121 21:39679430-39679452 AATCCAACAAGAGAAACAAGAGG - Intergenic
1180281537 22:10700183-10700205 AATCTAACCAGATAGAAATGAGG - Intergenic
1203238780 22_KI270732v1_random:32318-32340 AATCTAACCAGATAGAAATGAGG - Intergenic
949209676 3:1482777-1482799 AAAACAACCACATCAACAAGTGG + Intergenic
949892539 3:8744060-8744082 AGACTAATCAGATCAACAGGAGG - Intronic
949940950 3:9153994-9154016 ACTCAAACCAGATAAACAAGTGG - Intronic
952598017 3:35042882-35042904 TAAATAACCAGATGAACAAGAGG - Intergenic
955847017 3:63175280-63175302 AATCTGAACAGACCAACAACGGG + Intergenic
956144665 3:66180665-66180687 AATCTCATCAGGTCAACAACAGG - Intronic
956886139 3:73562060-73562082 AATCAAACCAGATCAAAAGATGG - Intronic
958477457 3:94602991-94603013 GATCCAACCAGATGAACAAGAGG - Intergenic
958508722 3:95016779-95016801 AAACCAACCCTATCAACAAGTGG + Intergenic
959257890 3:104037609-104037631 AAACCAACCCCATCAACAAGTGG - Intergenic
960363942 3:116748147-116748169 AATCAAACCCCATCAAAAAGTGG + Intronic
960468851 3:118034634-118034656 AATATTACAAAATCAACAAGTGG - Intergenic
963411613 3:144935165-144935187 AATCTGAACAGATCAATAACAGG + Intergenic
963992981 3:151674354-151674376 AATCTTTAGAGATCAACAAGTGG - Intergenic
966844805 3:184120295-184120317 AATCTACCCTGGGCAACAAGAGG + Intergenic
970149908 4:13078666-13078688 TATCTAACTACATCCACAAGTGG + Intergenic
974418333 4:61640165-61640187 AATCAAAGCTGTTCAACAAGCGG + Intronic
976773681 4:88683152-88683174 AACATAACCCCATCAACAAGTGG - Intronic
977973586 4:103238903-103238925 AAACAAACCCCATCAACAAGTGG - Intergenic
979020716 4:115493863-115493885 ACTCCAGCCAGGTCAACAAGAGG - Intergenic
979542052 4:121895649-121895671 AATCTAAACAGACCAAAAACAGG + Intronic
979852559 4:125591773-125591795 ACTGTCACCAGAACAACAAGGGG + Intergenic
982917871 4:161235969-161235991 TATCTAATCAGATAAACAGGAGG - Intergenic
983154984 4:164336127-164336149 TTTCTAACCAGACCACCAAGGGG + Intronic
983290369 4:165795924-165795946 AATCTGTCCAGTTCAAGAAGGGG - Intergenic
983895735 4:173079644-173079666 AAACTAACCCCATCAAAAAGTGG - Intergenic
983954849 4:173685667-173685689 AATCTAGTCAGATCTACAACTGG - Intergenic
984303508 4:177955460-177955482 AAACCAACCCCATCAACAAGTGG + Intronic
984563384 4:181297952-181297974 AAGCAAACCAGAACATCAAGTGG - Intergenic
986009511 5:3699722-3699744 AATATAACTAAATCAACAAGGGG - Intergenic
987485793 5:18524302-18524324 AATCCAGCCTGAGCAACAAGTGG - Intergenic
987827294 5:23048879-23048901 AATAAAACCACATGAACAAGAGG - Intergenic
993150805 5:84160032-84160054 ATTCTAACCAAATCCACAATTGG - Intronic
993972431 5:94435954-94435976 CAACTAACCAGATTAACAAGTGG - Intronic
994792262 5:104244260-104244282 AATCCAACTACATCACCAAGGGG + Intergenic
998293121 5:140936568-140936590 AATCTAACTGGATTTACAAGTGG - Intronic
998412163 5:141919656-141919678 AAACTAACCAGGTGAAGAAGAGG - Intergenic
999608934 5:153348518-153348540 AATCTAATGAGATCGACATGTGG - Intergenic
1003063517 6:2881655-2881677 AATCAAATCAAATCAAAAAGAGG + Intergenic
1008146701 6:47900403-47900425 ATTCTAAGAAGATAAACAAGTGG - Intronic
1010957670 6:82108628-82108650 AATAAAACCAGAGTAACAAGAGG + Intergenic
1013231762 6:108166772-108166794 AAGCCAGCCGGATCAACAAGTGG + Intronic
1013308851 6:108874634-108874656 AATCTCACCACATCCCCAAGAGG + Intronic
1016789924 6:148057407-148057429 AAACTAACCACATTAAAAAGTGG - Intergenic
1017537079 6:155359377-155359399 AATCTGAACAGACCAATAAGAGG + Intergenic
1017750324 6:157485483-157485505 AATCTAACCACATAAACACATGG - Intronic
1020517531 7:9141421-9141443 AATCAAACCCCATCAAAAAGTGG - Intergenic
1021264224 7:18499249-18499271 AATATAACTAGAACAACAAATGG - Intronic
1025485804 7:61046575-61046597 AATCTAACGGAATCAACAAATGG + Intergenic
1025641792 7:63380082-63380104 AATATCACCAGATAAACAAAAGG - Intergenic
1027513005 7:79107147-79107169 AGTCTAACCACATGAATAAGTGG + Intronic
1028255067 7:88585286-88585308 AAAATAACCCCATCAACAAGTGG - Intergenic
1030999407 7:116397512-116397534 AATCTGAACAGAATAACAAGAGG + Intronic
1033038422 7:137896332-137896354 ACTCTAACCTGGGCAACAAGAGG - Intronic
1033484058 7:141770789-141770811 AAAACAACCACATCAACAAGTGG - Intronic
1037066410 8:14583338-14583360 AATATAACCCCATCAAAAAGTGG - Intronic
1037389009 8:18373198-18373220 ACTCAAACCAGATCAAAATGTGG + Intergenic
1039505615 8:38050258-38050280 GATCTAAGCAAATCAACAGGAGG - Intronic
1041626682 8:60037125-60037147 AATCTAATCTGATCAAAAAATGG + Intergenic
1041953737 8:63534479-63534501 AATCAAACCCCATCAAAAAGTGG + Intergenic
1042967665 8:74372598-74372620 AATCAAACCCCATCAAAAAGTGG - Intronic
1043307492 8:78814537-78814559 AATCTTAGCAGATCAAAAACAGG - Intergenic
1050124710 9:2344684-2344706 TTTCTGACCAGATCAACTAGAGG + Intergenic
1050973444 9:11907279-11907301 AAAACAACCACATCAACAAGTGG - Intergenic
1052534401 9:29728871-29728893 AATGCAACCACATCAAAAAGTGG + Intergenic
1052879393 9:33591561-33591583 AATCATACCAGAAGAACAAGTGG - Intergenic
1055831983 9:80390664-80390686 AAACTAACCCCATCAAAAAGTGG + Intergenic
1203405138 Un_KI270528v1:765-787 AATCAAACGAGATCATCAAATGG - Intergenic
1187394939 X:18911204-18911226 ACTCCAACCTGAGCAACAAGAGG - Intronic
1192718990 X:73672598-73672620 AAACAAACCACATCAAAAAGTGG - Intronic
1192991999 X:76470236-76470258 AATCTAAACAGAGCAATAAGAGG - Intergenic
1194121969 X:89973365-89973387 AAAACAACCACATCAACAAGTGG + Intergenic
1194333186 X:92611310-92611332 AATCTAACCAAGGCAGCAAGAGG - Intronic
1196562656 X:117169137-117169159 AATCAAACCCCATCAAAAAGTGG + Intergenic
1200641871 Y:5730333-5730355 AATCTAACCAAGGCAGCAAGAGG - Intronic
1201787174 Y:17797475-17797497 AAACAAACCAAATAAACAAGTGG + Intergenic
1201814379 Y:18108513-18108535 AAACAAACCAAATAAACAAGTGG - Intergenic
1202349021 Y:23967082-23967104 AAACAAACCAAATAAACAAGTGG + Intergenic
1202521754 Y:25703022-25703044 AAACAAACCAAATAAACAAGTGG - Intergenic