ID: 923483244

View in Genome Browser
Species Human (GRCh38)
Location 1:234404394-234404416
Sequence CAACTTTGGTAGCTTGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 404}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923483244 Original CRISPR CAACTTTGGTAGCTTGAGTT TGG Intronic
900174079 1:1284236-1284258 CCACCTTGGTACCTTGAGGTGGG - Intronic
901471977 1:9463663-9463685 AAACTTTGTAACCTTGAGTTAGG - Intergenic
901557322 1:10041939-10041961 CAACTTTGGGAGGCTGAGGTGGG - Intronic
902069820 1:13724737-13724759 GAACTTTGGGAGGTTGAGATGGG - Intronic
902586533 1:17442436-17442458 CAACTTTGGGAGGCTGAGGTGGG - Intergenic
903308277 1:22430199-22430221 CTACTTTGGTTTTTTGAGTTGGG + Intergenic
903523288 1:23972160-23972182 CTACTTTGGGAGGTTGAGGTGGG + Intronic
904502865 1:30926544-30926566 GCACTTTGGGAGCCTGAGTTAGG + Intergenic
904524490 1:31122506-31122528 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
904649432 1:31993618-31993640 GAACTTTGGGAGATTGAGATGGG - Intergenic
905154819 1:35967661-35967683 GAACTTTGGGAGGTTGAGCTGGG - Intronic
905687801 1:39921397-39921419 CAACTTTGGTAGCTTGCAGTTGG + Intergenic
905818630 1:40971878-40971900 CAGCTTTGGTAGGCTGAGGTTGG + Intergenic
906261489 1:44394873-44394895 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
906665605 1:47619640-47619662 CTACTTTGGTAGGTAGATTTAGG + Intergenic
907538277 1:55185813-55185835 GAACTTTGGAAGCCTGAGCTGGG - Intronic
907974929 1:59422446-59422468 CAACTTTGGGAGGCTGAATTGGG + Intronic
908725139 1:67167610-67167632 GCACTTTGGGAGGTTGAGTTGGG + Intronic
912413468 1:109493241-109493263 CCACTTAGGGAGCTTGAGCTGGG + Intergenic
912923719 1:113894339-113894361 CTACTTTGATAGCTTGAGGGAGG + Intergenic
912982597 1:114389678-114389700 CCACATTGGTAGTATGAGTTTGG + Intergenic
913047348 1:115085675-115085697 CAACTTTAGAAACTTGAGTGGGG + Intronic
913137785 1:115909754-115909776 CAACTTTGGAAGGCTGAGGTGGG + Intergenic
913409746 1:118538014-118538036 AATCTTTGGTAGCTTGAAATTGG - Intergenic
914842494 1:151259950-151259972 GCACTTTGGTAGATTGAGGTGGG + Intronic
915542549 1:156577412-156577434 CAACTTTGGGAGACTGAGGTGGG - Intergenic
915567395 1:156723236-156723258 CATCTTTGGAAGCTAGATTTGGG - Exonic
915742610 1:158130575-158130597 CAACCTTGGAACCTTGATTTTGG - Intergenic
916891999 1:169121191-169121213 GAACTTTGGGAGGATGAGTTGGG - Intronic
917943289 1:179944836-179944858 CAACTTTGGGAGGCTGAGGTGGG - Intergenic
918167405 1:181963368-181963390 GCACTTTGGGAGCCTGAGTTGGG + Intergenic
918363159 1:183779493-183779515 CAACTTTGGGAGGCTGAGGTGGG - Intronic
919035320 1:192300058-192300080 CAACTTTGGGAGGCTGAGCTGGG - Intergenic
919127583 1:193414661-193414683 TCACATTGGTAGCTTGAGATTGG + Intergenic
919413336 1:197274842-197274864 CAACTTTGTTACTTTCAGTTTGG + Intronic
920006569 1:202837610-202837632 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
921610893 1:217210824-217210846 TTGCTTTTGTAGCTTGAGTTTGG + Intergenic
921894150 1:220381491-220381513 CAACTTTGGTAGCTTGAAATTGG - Intergenic
922058655 1:222066251-222066273 CAGTTTTGCTAGCTGGAGTTGGG + Intergenic
922524869 1:226293446-226293468 CAATTTTGTTAGCTAGACTTTGG - Intronic
922663941 1:227453142-227453164 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
923483244 1:234404394-234404416 CAACTTTGGTAGCTTGAGTTTGG + Intronic
1062792782 10:320261-320283 CAACTTTGGCAGGCTGAGGTGGG + Intronic
1063433354 10:6010329-6010351 CCACTTTGGGAGGCTGAGTTGGG + Intergenic
1063649142 10:7915730-7915752 CACCTTTGGGAGGTTGAGGTGGG + Intronic
1064382100 10:14853964-14853986 CAACTTTGGGAGGCTGAGATGGG - Intronic
1064678865 10:17789057-17789079 CCACCTTGGTAGCTTGAAATCGG - Intronic
1064739823 10:18421544-18421566 GAACTTTGGGAGGTTGAGGTGGG - Intronic
1064860483 10:19820058-19820080 CAAGTTTTGGAGCTTGAGGTTGG + Intronic
1065216035 10:23449693-23449715 CAACTTTGGAAGGCTGAGTTAGG - Intergenic
1065851818 10:29796690-29796712 AAGCTTGGGTAACTTGAGTTAGG + Intergenic
1066245907 10:33583190-33583212 ACACTTTGGGAGGTTGAGTTGGG - Intergenic
1066410563 10:35164801-35164823 GCACTTTGGGAGCCTGAGTTGGG + Intronic
1066652840 10:37675256-37675278 CAACTTTGGGAGGCTGAGGTGGG - Intergenic
1067767319 10:49096897-49096919 GAACTTTGGGAGGTTGAGGTGGG - Intronic
1068327364 10:55511117-55511139 CCACTTTGGAAGGCTGAGTTGGG - Intronic
1069042372 10:63709183-63709205 CAACTTTGGGAGGTCGAGGTGGG + Intergenic
1069352711 10:67548677-67548699 CAACTTTATAATCTTGAGTTAGG + Intronic
1069438841 10:68409506-68409528 GCACTTTGGAAGGTTGAGTTAGG - Intergenic
1069804372 10:71108893-71108915 CCACTTTGGCAGGTTGAGGTGGG - Intergenic
1070324809 10:75381467-75381489 GAACTTTGGAAGTTTGAGGTGGG - Intergenic
1071315773 10:84395626-84395648 CCAGCTTGGTAGCTTAAGTTGGG + Intronic
1071894336 10:90049444-90049466 ATACTTTGGCAGCTTGAGGTGGG + Intergenic
1072813427 10:98481681-98481703 CAACCTTGGTGGCTTGCATTTGG - Intronic
1073359012 10:102882296-102882318 CAACTTTGGGAGGCTGAGGTGGG - Intronic
1073458974 10:103654661-103654683 AAACTTTGGGAGGTTGAGGTGGG - Intronic
1074569714 10:114613381-114613403 CCACCTTGGTAGCTTGAAATTGG + Intronic
1075026694 10:118990157-118990179 CAACTTTGGGAGGCTGAGGTGGG - Intergenic
1075293057 10:121247019-121247041 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
1075771963 10:124946170-124946192 GCACTTTGGGAGATTGAGTTGGG + Intronic
1078361445 11:10671463-10671485 CAACTTTGGGAGGCTGAGGTGGG + Intronic
1079169098 11:18075115-18075137 CAACTTTAGTTGATTGTGTTGGG + Intronic
1079364632 11:19798612-19798634 CGACTTTGGAAGCCTGAGTTGGG + Intronic
1080007467 11:27424991-27425013 CAACTTTGGGAGCCTGAGGCGGG - Intronic
1081460114 11:43264845-43264867 AAACTTTGGGAGGTTGAGTCAGG + Intergenic
1082810917 11:57478405-57478427 GAAGTTTGGTAGTTTGAATTTGG + Intergenic
1083473780 11:62902336-62902358 CAAGTCTGGGTGCTTGAGTTGGG - Intergenic
1083588147 11:63875363-63875385 CAACTTTGGGAGGCTGAGGTGGG - Intronic
1085897971 11:80662587-80662609 AAACTTTGACAGCTTGAGTAAGG + Intergenic
1086679022 11:89645763-89645785 CAACTTTGGGAGGCTGAGGTGGG - Intergenic
1086926905 11:92650623-92650645 TCACTTTGGTAGCTTGAAATTGG - Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1087998353 11:104840775-104840797 CAACTCTAGAAGTTTGAGTTAGG + Intergenic
1088117033 11:106324001-106324023 CAACTTTAGGAGGTTAAGTTGGG + Intergenic
1088451570 11:109987027-109987049 CCACTTTGGGAGGTTGAGGTGGG + Intergenic
1090140797 11:124258308-124258330 GCACTTTGGGAGGTTGAGTTGGG + Intergenic
1090235035 11:125140719-125140741 CAACATTGGTGGAATGAGTTGGG - Intergenic
1090695685 11:129239094-129239116 GCACTTTGGTAGGTTGAGGTGGG - Intronic
1090869276 11:130728390-130728412 AGAGTTTGGTAGCTTGATTTTGG + Intergenic
1092234986 12:6801268-6801290 GAACTTTGGGAGTTTGAGGTGGG + Intronic
1092471264 12:8784107-8784129 CAACACTGGTAGGTTGAGGTGGG + Intergenic
1092859815 12:12710785-12710807 TCACTTTGGTAGGTTGAGTCAGG - Intergenic
1094203506 12:27816875-27816897 AACCTTTGGTAGCTTGAAATTGG + Intergenic
1095707275 12:45250959-45250981 GAACTTTGGGAGGTTGAGGTGGG + Intronic
1095799687 12:46258898-46258920 GCACTTTGGGAGGTTGAGTTAGG - Intronic
1096697049 12:53356027-53356049 CTACTTGGGAAGCTTGAGGTGGG + Intergenic
1097212364 12:57382065-57382087 GCACTTTGGGAGGTTGAGTTGGG - Intronic
1097985817 12:65782195-65782217 TAACTTTGATAGCTTGAAATTGG - Intergenic
1098530201 12:71533096-71533118 GAACTTTGGGAGGTTGAGGTGGG + Intronic
1099660670 12:85556075-85556097 CAGATTTGGTAGTTTGACTTAGG + Intergenic
1101340562 12:103839357-103839379 CTACTTGGGAGGCTTGAGTTGGG - Intronic
1102623202 12:114213434-114213456 CAAGTTCTGTGGCTTGAGTTTGG - Intergenic
1103987211 12:124775582-124775604 GCACTTTGGTAGGTTGAGGTGGG + Intergenic
1104045334 12:125158589-125158611 TAACTTTGGTTGCTTGGGTAAGG + Intergenic
1104538755 12:129643167-129643189 GCACTTTGGGAGCTTGAGGTGGG - Intronic
1105399186 13:20072824-20072846 CAAATTTGTTAGCCTAAGTTTGG + Intronic
1108142657 13:47441153-47441175 GCACTTTGGTAGCTTGACGTGGG - Intergenic
1109554172 13:63949368-63949390 TAACTTTGGTTACTTGAATTTGG - Intergenic
1112158585 13:96845219-96845241 AAACCTTGGTAGTCTGAGTTTGG - Intergenic
1112473296 13:99708846-99708868 CAACTTTGGGAGCCTGAGGTGGG + Intronic
1112984510 13:105431097-105431119 GAACTTTGGGAGGTTGAGGTGGG - Intergenic
1113048366 13:106181344-106181366 CCACTTTGGGAGGCTGAGTTAGG + Intergenic
1113145975 13:107207897-107207919 CAATTTTGGTAGGCTGAGATAGG - Intronic
1113433132 13:110267347-110267369 CATCTTTGTGAGCTTGAGTTGGG - Intronic
1115126917 14:30006915-30006937 ACACTTTGTCAGCTTGAGTTGGG + Intronic
1115237477 14:31221822-31221844 GAACTTTGGGAGGCTGAGTTGGG + Intergenic
1115531069 14:34327715-34327737 GAACTTTGGGAGGCTGAGTTGGG - Intronic
1115797330 14:36952819-36952841 CACCTTCTGTAGCTTGGGTTTGG + Intronic
1116730343 14:48613020-48613042 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
1117914765 14:60665742-60665764 AAACTTTGGTAGGTTGAGACTGG + Intergenic
1119324378 14:73751095-73751117 GCACTTTGGGAGGTTGAGTTGGG - Intronic
1119568284 14:75647218-75647240 GAACTCTGGTAGCTTGAGTTGGG + Exonic
1120016408 14:79478951-79478973 CACCTTTTGGAGCTTCAGTTTGG + Intronic
1121310845 14:92934250-92934272 AAACTTGGGTAGCCAGAGTTCGG + Intronic
1121345464 14:93132461-93132483 GAACTTTGGGAGCCTGAGGTAGG + Intergenic
1121838453 14:97112935-97112957 CAACTTTGGGAGGCTGAGGTGGG - Intergenic
1202889432 14_KI270722v1_random:141835-141857 GCACTTTGGGAGCTTGAGGTGGG - Intergenic
1126762810 15:51985093-51985115 CAACTTTGGAAGGATGAGGTGGG + Intronic
1127126975 15:55821133-55821155 ACACTTTGGGAGATTGAGTTGGG + Intergenic
1127363044 15:58261721-58261743 CATCTTTGCTGGCATGAGTTAGG - Intronic
1128242703 15:66111937-66111959 TTACTTTGGTAGCCTGATTTGGG - Intronic
1128405759 15:67336239-67336261 CAACTTTGGTATTTATAGTTTGG - Intronic
1129888295 15:79054031-79054053 GACCTTTGGTAGCTTGAAATGGG - Intronic
1129924726 15:79353955-79353977 CACATTTGGAAGCTTGTGTTTGG + Intronic
1131101421 15:89692852-89692874 GAACTTTGGGAGCTCGAGGTAGG - Intronic
1131106066 15:89735830-89735852 CAACTTCTGCAGGTTGAGTTAGG - Intronic
1133693044 16:8234769-8234791 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
1135492822 16:22924556-22924578 TCACTTTGGTAGCTTGAAATTGG - Intergenic
1136386490 16:29929663-29929685 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
1136557860 16:31018943-31018965 GAACTTTGGGAGGCTGAGTTAGG + Intergenic
1137518567 16:49172116-49172138 ACACTTTGGTAGCTTGAAATTGG - Intergenic
1137848675 16:51716336-51716358 CTACTTTGGTAGCTTGAAATGGG - Intergenic
1138736125 16:59252087-59252109 CCACTTTGGGAGGTTGAGATGGG + Intergenic
1139604242 16:68006685-68006707 GCACTTTGGAAGCTTGAGGTGGG + Intronic
1139911792 16:70401744-70401766 CCACTTTGGGAGCCTGAGGTGGG + Intronic
1140752874 16:78042003-78042025 CAACTTTGTTGGGTTGAGTTTGG - Intronic
1140810648 16:78573982-78574004 CTAATTTGGTAGCTTGACTGGGG + Intronic
1142856958 17:2736180-2736202 GCACTTTGGGAGCTTGAGGTGGG + Intergenic
1143194655 17:5066642-5066664 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
1143463344 17:7118306-7118328 CACCTTGGGAAGCTGGAGTTGGG + Intergenic
1143518492 17:7431991-7432013 CAACTTTAGTGGCTTGGGTAAGG - Intergenic
1143800206 17:9372855-9372877 AAACTTTGGTAGGCTGAGGTGGG + Intronic
1144561417 17:16323478-16323500 CCACTTTGGGAGGTTGAGGTGGG - Intronic
1146119612 17:30180400-30180422 CAACTTTGGGAGGCTGAGGTGGG - Intronic
1146217978 17:30994049-30994071 CAACTTTGGGAGGTTGAGGCAGG - Intronic
1147012809 17:37465034-37465056 CTACTTTGGGAGGTTGAGGTAGG + Intronic
1147493192 17:40891177-40891199 GCACTTTGGGAGCCTGAGTTGGG + Intergenic
1147543202 17:41378535-41378557 CCACTTTGGGAGGTTGAGGTGGG - Intronic
1147773261 17:42882482-42882504 CTACTTGGGAAGCTTGAGATAGG + Intergenic
1147957487 17:44144385-44144407 GAACTTTGGGAGGTTGAGGTGGG - Intronic
1148347142 17:46910878-46910900 CAACTTTGGGAGGTAGAGGTGGG + Intergenic
1149557372 17:57583762-57583784 AAACTTTGGGAGGTTGGGTTTGG - Intronic
1150768998 17:68025541-68025563 GCACTTTGGTAGGTTGAGGTAGG - Intergenic
1150809833 17:68347633-68347655 CAGCTTTGGTAGCTTGATCTTGG - Intronic
1151174877 17:72279358-72279380 GCACTTTGGGAGGTTGAGTTGGG - Intergenic
1151635539 17:75345288-75345310 CAACTTTGGGAGGCTGAGGTTGG - Intronic
1152243318 17:79171706-79171728 GCACTTTGGGAGGTTGAGTTGGG - Intronic
1152243328 17:79171774-79171796 GCACTTTGGGAGGTTGAGTTGGG - Intronic
1153539916 18:6142672-6142694 GAACTTTGGGAGTTTGAGGTGGG + Intronic
1153754425 18:8265476-8265498 CAAGTTTGTAAGCCTGAGTTGGG + Intronic
1155490110 18:26392661-26392683 CCACTTTGGTAGGCTGAGGTGGG + Intergenic
1155782219 18:29850695-29850717 GAACTCTGGTAGGTTGAGATGGG - Intergenic
1156317119 18:35980438-35980460 GCACTTTGGGAGGTTGAGTTAGG - Intergenic
1156357850 18:36358244-36358266 CACCTTTGGTGGCATGAGGTTGG + Intronic
1157032260 18:43925755-43925777 AAACTTTGGGAGGTTGAGGTGGG - Intergenic
1157108950 18:44801356-44801378 CTACTCTTGTAGCTTGAGTGAGG + Intronic
1158333317 18:56386866-56386888 CAACTTTGGTAAGCAGAGTTAGG + Intergenic
1158495517 18:57951800-57951822 CCACTTTGGTAGCTTCTGTTTGG - Intergenic
1159973354 18:74680142-74680164 GAACTTTGGGAGGTTGAGGTGGG + Intronic
1160261325 18:77296892-77296914 CAACATTGGTAGGATTAGTTTGG + Intergenic
1160321621 18:77901206-77901228 CCACTTTGGGAGGTTGAGGTGGG + Intergenic
1160611629 18:80092614-80092636 GAACTTTGGGAGGTTGAGGTGGG - Intronic
1160876531 19:1298989-1299011 CAACTTTGGGAGCCTGAGGCAGG + Intronic
1161034024 19:2074045-2074067 CAACTTTGGGAGGCTGAGGTGGG + Intronic
1161585797 19:5104839-5104861 CAACTTTGGGACCTGGAGTCAGG - Intronic
1162383140 19:10343859-10343881 GCACTTTGGGAGGTTGAGTTGGG - Intergenic
1162414199 19:10524568-10524590 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
1163733501 19:18964056-18964078 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
1163935015 19:20434690-20434712 GCACTTTGGTAGGCTGAGTTGGG + Intergenic
1164004936 19:21139934-21139956 GCACTTTGGTAGCCTGAGATGGG - Intergenic
1164111330 19:22161962-22161984 GCACTTTGGTAGCCTGAGGTGGG - Intergenic
1164793849 19:31010437-31010459 GCACTTTGGGAGGTTGAGTTAGG + Intergenic
1166285687 19:41826364-41826386 CAACTTTGGGAGGCTGAGGTGGG - Intergenic
1168538210 19:57189678-57189700 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
1202664835 1_KI270708v1_random:108604-108626 GCACTTTGGGAGCTTGAGGTGGG - Intergenic
924976483 2:180283-180305 CAACTCTTGTCTCTTGAGTTTGG + Intergenic
925725846 2:6870426-6870448 CAACTTTGGGACCATGAGGTGGG + Intronic
926100001 2:10108965-10108987 CCACTTTGGGAGGTTGAGGTGGG - Intergenic
926989361 2:18660892-18660914 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
928134118 2:28675259-28675281 CAACTTTGGAAGGCTGAGGTAGG + Intergenic
928830544 2:35477863-35477885 CAACTTTGGATGCTTGAGCCTGG + Intergenic
930504266 2:52263004-52263026 GAACTTTGGGAGGTTGAGGTGGG - Intergenic
931106254 2:59059560-59059582 CATCTTTGGTAGCCTGGGTTGGG + Intergenic
931364728 2:61609253-61609275 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
931990904 2:67789224-67789246 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
932150136 2:69363348-69363370 GCACTTTGGGAGCCTGAGTTGGG - Intronic
932245606 2:70193721-70193743 CAACTTTGGGAGGCTGAGGTGGG - Intronic
935688833 2:105712221-105712243 CCACTTTGGGAGGTTGAGGTGGG - Intergenic
936792777 2:116169322-116169344 GAACTTTGGGAGGCTGAGTTGGG + Intergenic
937600850 2:123730031-123730053 GAACTTTGGGAGGCTGAGTTGGG - Intergenic
937857846 2:126685629-126685651 CAACTTTGGGAGGCTGAGGTGGG - Intronic
939459427 2:142480167-142480189 CAGCTAGGGAAGCTTGAGTTAGG + Intergenic
939561525 2:143738002-143738024 CAACTTTGGGAGGCTGAGATGGG - Intronic
939928508 2:148202779-148202801 CCACTTTGGTAGGCTGAGGTGGG + Intronic
940826108 2:158415027-158415049 CAAATTTATTACCTTGAGTTTGG - Intronic
940909307 2:159196247-159196269 CAACTTTGGTTGCTTGGGTGGGG - Intronic
942051327 2:172143689-172143711 CAAGTTTTGTATCTTGAATTGGG - Intergenic
942087512 2:172457045-172457067 ACACTTTGGGAGGTTGAGTTGGG + Intronic
942804961 2:179919639-179919661 TCACTTTGGTAGCTTGAAATTGG + Intergenic
943121897 2:183746928-183746950 CAACTTTGGGAGGCTGAGCTGGG - Intergenic
943651606 2:190463572-190463594 CAACTTTGGGAGGCTGAGATAGG + Intronic
943734655 2:191340967-191340989 CAACTTTGGGAGGCTGAGGTGGG - Intronic
944749024 2:202689192-202689214 GCACTTTGGGAGCTTGAGGTGGG + Intronic
946699759 2:222400627-222400649 GAACTTTGGTAGCCTGAGGCAGG - Intergenic
947029409 2:225776034-225776056 CAGCTTTGTTGGCTAGAGTTGGG - Intergenic
947758621 2:232587463-232587485 CAGCTTTGGGAGCTTGAGGCAGG - Intergenic
948646081 2:239406015-239406037 CAACTTTGGTAGCTTTTGACTGG - Intergenic
1169370232 20:5023291-5023313 ACACTTTGGTAGGTTGAGGTGGG - Intergenic
1169376094 20:5067686-5067708 GAACTTTGGGAGGTTGAGGTAGG - Intergenic
1169442340 20:5643141-5643163 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
1169461218 20:5797312-5797334 ACACTTTGGGAGCCTGAGTTAGG + Intronic
1169492820 20:6085601-6085623 CAACTTTGGGAGGTTGAGGTGGG + Intronic
1171573327 20:26274578-26274600 GCACTTTGGGAGCTTGAGGTGGG + Intergenic
1171818381 20:29809669-29809691 CCACTTTGGGAGGTTGAGTTGGG - Intergenic
1171837535 20:30170830-30170852 GCACTTTGGGAGCTTGAGGTGGG - Intergenic
1172417362 20:34780898-34780920 GCACTTTGGGAGATTGAGTTGGG - Intronic
1176740819 21:10600383-10600405 GCACTTTGGTAGGTTGAGGTGGG - Intronic
1178506313 21:33166084-33166106 CTACTTTGGGAGGCTGAGTTAGG - Intronic
1178838167 21:36115778-36115800 GAACTTTGGGAGCCTGAGGTGGG - Intergenic
1178886921 21:36492055-36492077 GCACTTTGGGAGCTTGAGGTGGG + Intronic
1179664338 21:42899824-42899846 CAACTTTGGGAGGTTGAGGCAGG - Intronic
1180331563 22:11485523-11485545 GCACTTTGGGAGCTTGAGGTGGG - Intergenic
1180573924 22:16754912-16754934 GCACTTTGGGAGCTTGAGGTGGG - Intergenic
1181385933 22:22545856-22545878 GCACTTTGGGAGGTTGAGTTGGG + Intergenic
1182225925 22:28798865-28798887 GCACTTTGGGAGCCTGAGTTGGG - Intronic
1182607833 22:31520747-31520769 GAACTTTGGGAGGTTGAGGTGGG + Intronic
1183518388 22:38281539-38281561 GCACTTTGGGAGGTTGAGTTGGG - Intergenic
1183681187 22:39330390-39330412 CCACTTTGGGAGCCTGAGGTGGG + Intergenic
949482660 3:4508817-4508839 CAGCTTTGGTATTGTGAGTTTGG + Intronic
949494710 3:4620610-4620632 CAACTTGGGAAGATTGATTTGGG + Intronic
950783702 3:15414599-15414621 CAACTTTGGGAGACTGAGGTGGG - Intronic
951292944 3:20896434-20896456 GCACTTTGGTAGGTTGAGGTGGG + Intergenic
951650083 3:24941612-24941634 CAACTTTGGGAGGCTGAGGTGGG - Intergenic
952266881 3:31795389-31795411 CAACTTTGGGAGGCTGAGGTGGG - Intronic
952375193 3:32761310-32761332 CAACATTGGCATTTTGAGTTGGG - Intronic
952380579 3:32801421-32801443 CCACTTTGGGAGGTTGAGGTGGG - Intergenic
953562728 3:44006225-44006247 CAAATTTGATAGCTTAAGCTTGG + Intergenic
954126473 3:48533606-48533628 GAACTTTGGGAGGTTGAGGTGGG + Intronic
954623427 3:52008715-52008737 ACACTTTGGGAGCCTGAGTTGGG + Intergenic
955866372 3:63388664-63388686 CAACTTTGGGAGGCTGAGGTGGG - Intronic
957584765 3:82119570-82119592 AAACATTGGTAGCTTGAAGTTGG + Intergenic
957833380 3:85552624-85552646 ACACTTTGGTAGGTTGAGGTGGG - Intronic
959684137 3:109126593-109126615 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
961310342 3:125994525-125994547 CAACTTTGGAAGGTTGAGGCAGG + Intergenic
962110210 3:132437413-132437435 AATCTTTGTTAGCTTGGGTTAGG - Intronic
962497234 3:135953217-135953239 CAAGTTTGGGAGTTAGAGTTGGG + Intergenic
963110979 3:141687794-141687816 CAACTTTGGGAGGCTGAGATGGG - Intergenic
963347453 3:144112377-144112399 CAATTTTGTATGCTTGAGTTGGG + Intergenic
963902751 3:150747692-150747714 GAACTTTGGGAGGTTGAGTCGGG + Intronic
965280814 3:166750136-166750158 CATCTTTGGAAGTTTGACTTAGG + Intergenic
966189245 3:177256747-177256769 CAACTTTGGGAGGTTGAAGTGGG - Intergenic
966751804 3:183329431-183329453 AAACTTTGGGAGGTTGAGGTGGG - Intronic
967276272 3:187778388-187778410 CAACTTTGGGAGACTGAGGTGGG + Intergenic
967394896 3:188997125-188997147 CCACTTTGGTAGGTTGAGGCTGG - Intronic
968672956 4:1862229-1862251 CGTCTTTGGCAGCCTGAGTTAGG - Intergenic
971399646 4:26264127-26264149 GCACTTTGGGAGGTTGAGTTGGG - Intronic
971862225 4:32122614-32122636 CCACTTTGGCAGGTTGAGATGGG - Intergenic
972773508 4:42220163-42220185 CAACTTTGGGAGGCTGAGGTGGG - Intergenic
974040717 4:56855021-56855043 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
974625764 4:64427516-64427538 GAACTTTGGGAGGTTGAGGTGGG - Intergenic
974708637 4:65558121-65558143 CCACTTTGGGAGGTTGAGGTGGG - Intronic
974722124 4:65753994-65754016 CAACTTTGGGAGGCTGAGGTGGG - Intergenic
974805719 4:66877688-66877710 AAACTTAGGTAACTAGAGTTGGG + Intergenic
975451729 4:74535761-74535783 GAACTTTGGTGGCTTGCCTTAGG + Intergenic
975842000 4:78484537-78484559 CATCTTTGTTACCTTGGGTTAGG - Intronic
975925403 4:79445014-79445036 CAATTTTGGTAACATTAGTTTGG + Intergenic
976241902 4:82966853-82966875 GCACTTTGGTAGGTTGAGGTGGG - Intronic
976525715 4:86085212-86085234 TTACTTTGGTTGCTTGTGTTTGG - Intronic
976715938 4:88122457-88122479 CAACCTGGGAAGCTTGAGCTTGG + Intronic
977423106 4:96828645-96828667 GAGCTTTGGAAGCTTGAGGTAGG - Intergenic
977991190 4:103444358-103444380 GAACTTTGGGAGGTTGAGGTGGG - Intergenic
982478697 4:155882639-155882661 CCACTTTGGGAGGTTGAGGTGGG - Intronic
982739263 4:159040710-159040732 CAACTTTGGGAGGCTGAGGTAGG - Intergenic
983287328 4:165755947-165755969 GAACTTTGGTAGGCTGAGGTGGG - Intergenic
983881774 4:172940920-172940942 CAACTTTGGGAGGTTGAGGCTGG - Intronic
984824240 4:183910008-183910030 CAGATTTGGTAGCATGAGTTGGG - Intronic
987592431 5:19947492-19947514 AAACTTTGGGAGGCTGAGTTGGG + Intronic
988346034 5:30039152-30039174 GAACTTTGGGAGGTTGAGATGGG + Intergenic
988656887 5:33221508-33221530 GCACTTTGGGAGGTTGAGTTGGG + Intergenic
989280610 5:39638551-39638573 CTTCTTTTGGAGCTTGAGTTAGG + Intergenic
989516705 5:42352556-42352578 CAAATTTGGTATCTTGATATAGG + Intergenic
990955681 5:61336014-61336036 GAACTTTGGGAGGTTGAGGTGGG + Intronic
991106613 5:62851272-62851294 CAACTGTGGTAGATTGAGCTGGG + Intergenic
992050682 5:72937769-72937791 AAACTTTGGTAGCCTGATTGAGG - Intergenic
992506076 5:77388925-77388947 CAACTTGGGATGCTTGAGCTTGG - Intronic
992511811 5:77444124-77444146 GCACTTTGGGAGCTTGAGGTGGG - Intronic
992767888 5:80019097-80019119 CAACTATAGTAGCATGAATTTGG + Intronic
992772853 5:80064618-80064640 CAACCTTGGGAGGTTGAGGTGGG + Intronic
992844017 5:80726713-80726735 CAACTTTGGCAGACTGAGGTGGG - Intronic
992996404 5:82338427-82338449 GCACTTTGGGAGGTTGAGTTGGG + Intronic
993198923 5:84787307-84787329 CAACATTAGTAGTTTTAGTTGGG + Intergenic
993748086 5:91627224-91627246 TAACATTGGTAGCTAGAATTTGG + Intergenic
994689288 5:102997271-102997293 GAACTTTGGGAGGTGGAGTTGGG + Intronic
995564474 5:113419441-113419463 GCACTTTGGGAGCTTGAGGTGGG - Intronic
995846992 5:116503886-116503908 TAAGTTTGGAACCTTGAGTTAGG + Intronic
996160432 5:120155334-120155356 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
996651703 5:125885506-125885528 CAACTTTGGGAGTCTGAGGTGGG + Intergenic
996709000 5:126525541-126525563 GAACTTTGGGAGGTTGAGATGGG - Intergenic
997105690 5:131016813-131016835 CAACTGTCGTAGCTTAAGTCAGG - Intergenic
997216645 5:132117047-132117069 CAACTTGGGATGCTTGAGCTTGG + Intergenic
998288644 5:140890117-140890139 TCACTTTGGTAGCTTGAAATTGG + Intronic
998607605 5:143650830-143650852 CAAGTTTGAAAGCTGGAGTTTGG + Intergenic
999033813 5:148324428-148324450 CAACTTTGATCACTTGAGTAAGG - Intronic
1003929987 6:10914990-10915012 GAACTTTGGGAGGCTGAGTTGGG - Intronic
1005971035 6:30761984-30762006 TAACATTGGTAGCTTGAAGTTGG + Intergenic
1006542574 6:34752432-34752454 GCACTTTGGGAGGTTGAGTTGGG + Intergenic
1006696296 6:35933196-35933218 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
1006949910 6:37813162-37813184 GAACTTAGGCAGCCTGAGTTTGG + Intergenic
1007999259 6:46341550-46341572 CCACTTTGGGAGCCTGAGGTGGG + Intronic
1008881144 6:56381637-56381659 CAACTTTTGTAGCTTATGTTCGG - Intronic
1010107211 6:72183353-72183375 GAACTTTTGTAGCCTAAGTTTGG - Intronic
1011000996 6:82588570-82588592 AAACTTTGGGAGGCTGAGTTGGG + Intergenic
1014134906 6:117877502-117877524 CCACTTTGGGAGGTTGAGGTGGG + Intergenic
1015007685 6:128303261-128303283 CAGCTTTGGAAGCTGTAGTTAGG - Intronic
1015636623 6:135281357-135281379 AAAGTTTGGTAGCTTCAGTTTGG - Intergenic
1015647819 6:135414364-135414386 CACCTTTGTGAGCTTGGGTTAGG + Intronic
1015872066 6:137786775-137786797 GCACTTTGGGAGCCTGAGTTGGG + Intergenic
1016999507 6:149986322-149986344 CCACTTTGGGAGGCTGAGTTGGG + Intergenic
1017013825 6:150083999-150084021 CAAGTGTGCTAGCTTGAGATTGG - Intergenic
1018035939 6:159881236-159881258 CCACTTTGGGAGATTGAGGTAGG + Intergenic
1018330026 6:162717328-162717350 CAACTTTGGGAGACTGAGGTGGG + Intronic
1019377705 7:703398-703420 CCACTTTGGGAGGTTGAGGTGGG + Intronic
1019903952 7:4046186-4046208 GAACTTTGGGAGGTTGAGGTAGG - Intronic
1020228263 7:6297084-6297106 GAACTTTGGGAGGTTGAGTTGGG + Intergenic
1020774693 7:12438293-12438315 AAACTTTGGGAGGTTGAGGTGGG + Intergenic
1020927208 7:14345359-14345381 AAATTTTGGTATTTTGAGTTTGG - Exonic
1022722054 7:32950249-32950271 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
1023016665 7:35975130-35975152 GAACTTTGGGAGGTTGAGGTGGG - Intergenic
1023027809 7:36066851-36066873 ACACTTTGGGAGCTTGAGGTGGG + Intergenic
1024124828 7:46282870-46282892 AAACTTTTGGAGCTTGAGGTTGG + Intergenic
1025872818 7:65450557-65450579 GAACTTTGGGAGGTTGAGGTGGG - Intergenic
1027129420 7:75580489-75580511 GAACTTTGGGAGGCTGAGTTGGG + Intronic
1027177455 7:75913940-75913962 GAACTTTGGTAGGCTGAGGTGGG - Intronic
1027240377 7:76323887-76323909 CAACTTTGGGAGGCTGAGCTGGG - Intergenic
1029828029 7:103221618-103221640 CTACATTGGTAGCATGATTTGGG - Intergenic
1030010155 7:105157817-105157839 CAACTTTGGGAGGCTGAGATGGG + Intronic
1030137236 7:106266587-106266609 CAAAGTTGGTAATTTGAGTTGGG - Intronic
1030322587 7:108184699-108184721 CATGTTTGGTTGCTTGTGTTGGG - Intronic
1031078022 7:117231518-117231540 CAACTTCGGTAGGTCGACTTTGG - Intergenic
1031933568 7:127712403-127712425 CAACTTTGGGAGCTCAAGGTGGG - Intronic
1032391761 7:131559571-131559593 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
1032599973 7:133283319-133283341 CCACTTTGGGAGCCTGAGGTGGG - Intronic
1033207574 7:139436147-139436169 CCACTTTGGGAGCCTGAGGTGGG - Intergenic
1034367966 7:150568247-150568269 CAGCTTTGGTGGCTGGTGTTAGG - Intronic
1036440164 8:8774757-8774779 GAACTTTGGGAGCTTGAGGTGGG - Intergenic
1037269491 8:17110821-17110843 CTACTTTGGGAGGTTGAGGTGGG - Intronic
1037610984 8:20476125-20476147 GAACTTTGGGAGTTTGAGTTGGG - Intergenic
1037798014 8:22012711-22012733 GAAATTAGGTAGCATGAGTTAGG - Intergenic
1038551729 8:28475566-28475588 CAACATTGGTTGCATGGGTTGGG - Intronic
1039008906 8:33071576-33071598 CAGCGTTACTAGCTTGAGTTTGG - Intergenic
1039089905 8:33816723-33816745 GCACTTTGGGAGCTTGAGGTAGG + Intergenic
1041074057 8:54152696-54152718 CTACTTTGGGAGGTTGAGGTGGG + Intergenic
1041095659 8:54347076-54347098 CAACTTTGGGAGATTGAGGCAGG - Intergenic
1041913499 8:63115211-63115233 GAACTTTGGGAGGTTGAGGTGGG - Intergenic
1043606876 8:82011324-82011346 CAAATTTGGTAGTATGATTTTGG + Intergenic
1043748957 8:83911133-83911155 CAACTCTTGTCTCTTGAGTTTGG + Intergenic
1045102144 8:98855772-98855794 CCACTTTGGGAGGTTGAGGTGGG + Intronic
1045769199 8:105714708-105714730 TAACATTGGTAGCTTGAAGTTGG + Intronic
1046150713 8:110221049-110221071 GCACTTTGGGAGGTTGAGTTGGG + Intergenic
1047101446 8:121680643-121680665 GCACTTTGGGAGCCTGAGTTGGG + Intergenic
1047466256 8:125117624-125117646 CTACTTTGGGAGGCTGAGTTGGG - Intronic
1047644945 8:126860648-126860670 CAACTTTGGGAGGCTGAGGTAGG + Intergenic
1048323984 8:133424804-133424826 AAACTTTGGTAGCTTGAAATTGG - Intergenic
1050340666 9:4635118-4635140 ATAATTTGGTACCTTGAGTTGGG + Intronic
1050488874 9:6166015-6166037 CAGCTTTAGTAGTCTGAGTTTGG - Intergenic
1052570351 9:30213655-30213677 GAACTTTGGGAGCCTGAGGTTGG + Intergenic
1055119268 9:72639901-72639923 TAATTTTGGTTGCTGGAGTTGGG - Intronic
1055664394 9:78538998-78539020 GAGCTTTGGTAGCTTGAATAGGG + Intergenic
1055944698 9:81682305-81682327 CATCTATTGAAGCTTGAGTTGGG - Intronic
1056481336 9:87009567-87009589 GAACTTTGGGAGCCTGAGTGGGG - Intergenic
1056836422 9:89959409-89959431 GCACTTTGGTAGGTTGAGGTGGG + Intergenic
1058684074 9:107465650-107465672 CAACTTTGGTAGCTTCAACAGGG + Intergenic
1058798980 9:108526453-108526475 CAACTTTGGTCTCTAGAGTTAGG + Intergenic
1060120624 9:120986147-120986169 CAACCTTAGTCTCTTGAGTTTGG + Intronic
1061496528 9:130977954-130977976 CAACTCTGGCAGCCTGAGCTGGG + Intergenic
1062039618 9:134398224-134398246 CAACTTTGGGAGGCTGAGGTGGG - Intronic
1203486561 Un_GL000224v1:61238-61260 GCACTTTGGAAGCTTGAGTTGGG - Intergenic
1203499182 Un_KI270741v1:3137-3159 GCACTTTGGAAGCTTGAGTTGGG - Intergenic
1185781843 X:2854685-2854707 GCACTTTGGGAGCTTGAGATGGG + Intronic
1185882887 X:3757057-3757079 CCACTTTGGGAGGTCGAGTTGGG - Intergenic
1186374563 X:8985195-8985217 TAATTTTGGTAACTTGAGATGGG + Intergenic
1186621182 X:11241628-11241650 AAACTTTGATAACATGAGTTTGG - Intronic
1186985550 X:15009845-15009867 GAACTTTGGGAGGTTGAGGTGGG - Intergenic
1187296458 X:18006053-18006075 AACCTTTGGTAGCTTGAAATGGG - Intergenic
1188023988 X:25189140-25189162 CAACCTTTGTAGCTTGAACTTGG + Intergenic
1189253302 X:39618141-39618163 AACCTTTGGTATCTTGATTTGGG + Intergenic
1190121956 X:47668668-47668690 GCACTTTGGGAGCTTGAGGTGGG + Intergenic
1190742634 X:53300004-53300026 CAACTTTGGGAGGCTGAGGTGGG - Intronic
1191754409 X:64578806-64578828 GAACTTTGGGAGGCTGAGTTGGG - Intergenic
1193266848 X:79482301-79482323 CAACCTGGGATGCTTGAGTTTGG + Intergenic
1193878733 X:86896140-86896162 CAACTTGGGATGCTTGAGATTGG + Intergenic
1194124732 X:90002134-90002156 GAACTTTGGGAGGCTGAGTTGGG - Intergenic
1196378506 X:115063341-115063363 CAACTTTGGTAGGTCAAGGTGGG + Intergenic
1196655512 X:118213592-118213614 GAACTTTGGGAGGCTGAGTTGGG + Intergenic
1197069993 X:122285269-122285291 CCACTTTGGGAGCCTGAGGTGGG + Intergenic
1197712460 X:129681364-129681386 GCACTTTAGTAGCTTGAGGTGGG - Intergenic
1197756669 X:130000282-130000304 GAACTTTGGGAGGTTGAGCTGGG - Intronic
1197851748 X:130869460-130869482 TGAGTTTGGTAGCTGGAGTTTGG - Intronic
1198305172 X:135374677-135374699 GAACTTTGGGAGGTCGAGTTGGG + Intergenic
1198313055 X:135438628-135438650 CAACTTTGGTCCCTTCAGTGTGG - Intergenic
1198422128 X:136478718-136478740 CAACTTTGGGAGGCTGAGGTGGG + Intergenic
1199666225 X:150098552-150098574 CAACTTTGGCAGTTTGGCTTCGG - Intergenic
1199769188 X:150963319-150963341 GAACTTTGGGAGGTTGAGGTGGG + Intergenic
1199977059 X:152900338-152900360 CACCTGTGGAAGCTTGAGTAGGG - Intergenic
1200477624 Y:3659744-3659766 GAACTTTGGGAGGCTGAGTTGGG - Intergenic
1201479170 Y:14418955-14418977 GCACTTTGGGAGGTTGAGTTGGG + Intergenic
1202042481 Y:20699655-20699677 CAACAATGGTAGACTGAGTTGGG + Intergenic
1202173636 Y:22077489-22077511 CCACTTTGGGAGGCTGAGTTGGG + Intronic
1202217725 Y:22508893-22508915 CCACTTTGGGAGGCTGAGTTGGG - Intronic
1202325460 Y:23687166-23687188 CCACTTTGGGAGGCTGAGTTGGG + Intergenic
1202545311 Y:25982888-25982910 CCACTTTGGGAGGCTGAGTTGGG - Intergenic