ID: 923485661

View in Genome Browser
Species Human (GRCh38)
Location 1:234428525-234428547
Sequence GGGAAATCTGTATGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923485661_923485664 0 Left 923485661 1:234428525-234428547 CCAGTTTTTCATACAGATTTCCC 0: 1
1: 0
2: 4
3: 24
4: 225
Right 923485664 1:234428548-234428570 AACTTTTTTTTTTTTTGAGATGG 0: 361
1: 3395
2: 15991
3: 120488
4: 89974
923485661_923485666 25 Left 923485661 1:234428525-234428547 CCAGTTTTTCATACAGATTTCCC 0: 1
1: 0
2: 4
3: 24
4: 225
Right 923485666 1:234428573-234428595 TCTTGCTCTGTTGCCCAGGCTGG 0: 19870
1: 65461
2: 149698
3: 191149
4: 205218
923485661_923485665 21 Left 923485661 1:234428525-234428547 CCAGTTTTTCATACAGATTTCCC 0: 1
1: 0
2: 4
3: 24
4: 225
Right 923485665 1:234428569-234428591 GGAGTCTTGCTCTGTTGCCCAGG 0: 8345
1: 35403
2: 95445
3: 137050
4: 165011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923485661 Original CRISPR GGGAAATCTGTATGAAAAAC TGG (reversed) Intronic
902295721 1:15465635-15465657 TGGAAACCTGTAAGAAACACAGG + Intronic
907698656 1:56760524-56760546 GGGCAAACTGTATCACAAACAGG - Intronic
909588003 1:77312787-77312809 GGAAAAACTGGAAGAAAAACTGG - Intronic
909775481 1:79479308-79479330 TGGAAATTTTTATGAAATACAGG - Intergenic
909974617 1:82030468-82030490 GCAAAATCTGTATGAGAAAAAGG - Intergenic
910955114 1:92694641-92694663 AGGAAAACTTTATAAAAAACAGG + Intronic
912087957 1:106033676-106033698 GGGAAATTTAAATGAAAGACTGG + Intergenic
913698086 1:121347209-121347231 GGCAAATCTGAATTAAAATCTGG + Intronic
914139464 1:144932843-144932865 GGCAAATCTGAATTAAAATCTGG - Intronic
915098664 1:153483004-153483026 GGAAAGTCTGTATAAAAAGCAGG - Intergenic
917493394 1:175517720-175517742 AGGAAGTGTGTATGAAACACAGG - Intronic
920485481 1:206365859-206365881 GGCAAATCTGAATTAAAATCTGG + Intronic
922144731 1:222930055-222930077 GGGAAATATGTATTATAAAGTGG + Intronic
923279829 1:232432715-232432737 GGGAAATCTGATAGAAAAATGGG + Intronic
923485661 1:234428525-234428547 GGGAAATCTGTATGAAAAACTGG - Intronic
924318728 1:242825579-242825601 GGGACATATGCATAAAAAACCGG + Intergenic
1064313713 10:14235455-14235477 GGGGAGTGTGTATGAAAAAATGG - Intronic
1065882825 10:30051675-30051697 GGGAAATCTGGCAGAAAAGCAGG + Intronic
1066309818 10:34185389-34185411 TGGAGATCTGTATGACAAATTGG - Intronic
1066333563 10:34452156-34452178 GGGAAATGAGTATGAAAGCCTGG - Intronic
1067920253 10:50448442-50448464 GGGAAATAAGAATGAAAGACAGG + Intronic
1068832528 10:61513070-61513092 TGGATATCTGTATGGAAAACAGG - Intergenic
1070454980 10:76604120-76604142 AGGAAACCTGTAAGAAAAATTGG + Intergenic
1071149533 10:82618057-82618079 AGGAAATCTGTCTAAAACACTGG - Intronic
1072063162 10:91837557-91837579 TAGAAATATGTATGTAAAACTGG + Intronic
1072801605 10:98396018-98396040 AGGAGCTCTGTGTGAAAAACAGG - Intronic
1072839146 10:98751116-98751138 GGGAAATACGTAACAAAAACAGG - Intronic
1073227104 10:101931123-101931145 TGGAAATATGTAGGAAAAAACGG + Intronic
1075183418 10:120232900-120232922 TGGAAATGTGAATGAATAACTGG + Intergenic
1077665505 11:4104953-4104975 GGAGAATCTGAATGAAAAATGGG + Intronic
1077831881 11:5881423-5881445 GGGAAAGCTGTAAGAATAAGAGG + Intronic
1079527084 11:21403673-21403695 GATAATTCTGTATGAACAACAGG + Intronic
1080176250 11:29366339-29366361 GGAAAATTAGTATGAAAAGCTGG - Intergenic
1081249243 11:40809378-40809400 GTGATATCTGTGTGAAAAATAGG - Intronic
1081311345 11:41577389-41577411 CGGAAAACTGTATTAAAAATAGG - Intergenic
1081621071 11:44619449-44619471 GGGGCAACTGTATGAAAAATTGG + Exonic
1082302482 11:50525826-50525848 GGGGAAGCTATATGAGAAACGGG + Intergenic
1083378472 11:62244982-62245004 GGGAAATCTGTAAGGAATGCAGG - Intergenic
1083384273 11:62296085-62296107 GGGAAATCTGTAAGGAATCCAGG + Intergenic
1089206077 11:116763912-116763934 AGGTAATCTCTATGAAACACTGG - Intronic
1092929914 12:13306060-13306082 GGGAAATGTGTATGAATAAAAGG - Intergenic
1093337032 12:17918836-17918858 GGGTAATTTGTAAGAAAAAGAGG + Intergenic
1093733799 12:22595575-22595597 GGGAATTCTGTATGGAGAACAGG - Intergenic
1094799424 12:34015772-34015794 GGGACTTCTTGATGAAAAACTGG + Intergenic
1095663736 12:44769535-44769557 TGGAAAACTGTTTGGAAAACTGG + Intronic
1096738417 12:53674383-53674405 GGGAAACTTGTTTGAAATACAGG - Intronic
1099064858 12:77963233-77963255 GGGAAATCCATATTAAAAACAGG + Intronic
1099166131 12:79309182-79309204 GGGCACTTTGTATGAAAAAAGGG + Intronic
1100052275 12:90462721-90462743 GGGTAATCTATAAGAAAAATGGG + Intergenic
1100728414 12:97435455-97435477 GGGAAAACAGTATGAAAAAGTGG + Intergenic
1102700626 12:114835939-114835961 GTGCAATCAGTTTGAAAAACAGG + Intergenic
1103359004 12:120342691-120342713 GGGAAATCTGAATAAAAAACAGG + Exonic
1105715882 13:23064471-23064493 TGGTAATCTGTAAGGAAAACTGG - Intergenic
1109470301 13:62795251-62795273 GGTAATTCTTTATGAAAATCTGG + Intergenic
1110156000 13:72317442-72317464 GTGAAATGTGCATGAATAACAGG - Intergenic
1111199512 13:84915374-84915396 GAGAAATATGTATGAAACCCGGG - Intergenic
1111398236 13:87696807-87696829 GGGAACTATGAATGAAAAAATGG - Intergenic
1111788667 13:92824422-92824444 GGGAAATGTCTTTGAAAACCTGG - Intronic
1112311461 13:98320899-98320921 CGGAAATCTAAATGTAAAACTGG + Intronic
1112761830 13:102700389-102700411 GGGAAATCTGTTTTAAGGACTGG - Intergenic
1113105484 13:106767801-106767823 GGGAAATGTGTCAGGAAAACAGG - Intergenic
1116033593 14:39601959-39601981 GGGAAATGTTCATGAAAAAGGGG + Intergenic
1116499243 14:45600565-45600587 GGCAAATATGTAAGAAAAAGAGG + Intergenic
1119070297 14:71576486-71576508 AGGAAATCTGGATGTAAACCTGG + Intronic
1119287357 14:73466522-73466544 GGGAAATAGGCATGAAAATCAGG - Intergenic
1119378898 14:74216256-74216278 TGGAAAAGTGTATGAAAAACTGG - Intergenic
1119682506 14:76603454-76603476 GGGAAGTGTGTAGGAAAAATGGG + Intergenic
1120818671 14:88891469-88891491 GGGGAATCAGTATCAAAAAGAGG - Intergenic
1121772320 14:96557816-96557838 GGTAAATGAGAATGAAAAACGGG + Intronic
1128851629 15:70963532-70963554 GGGAAACCTGGATAAAATACAGG + Intronic
1128889231 15:71316106-71316128 TGGAAATCTGCTTGCAAAACAGG + Intronic
1129978070 15:79839510-79839532 TGGAAATGTGGATGAAATACTGG + Intronic
1130336495 15:82961248-82961270 AGGAAATCTGTATGAGTAAGTGG - Intronic
1130922015 15:88355245-88355267 TGGAAATCTGTTTCAGAAACAGG - Intergenic
1133842819 16:9425413-9425435 GGGAAATCTGCAAGAGAAATCGG - Intergenic
1134182286 16:12057477-12057499 GGGAAAGCAGTTTGACAAACTGG + Intronic
1135950177 16:26906875-26906897 GGGAAATCTGTCAGAGAAATCGG - Intergenic
1137373378 16:47929502-47929524 GGGAAATGTGTATGCACCACAGG + Intergenic
1138135369 16:54516811-54516833 GAGAAATTTGTATGAAAAACTGG + Intergenic
1139495745 16:67315973-67315995 CAGAAATCTGAATGAAAAAGGGG - Intronic
1140354916 16:74297220-74297242 GGGAACTCTGTAAAACAAACAGG - Intronic
1141094012 16:81149864-81149886 CGGAAGTCTTCATGAAAAACAGG + Intergenic
1141470523 16:84235253-84235275 TGGAAATCTGTAAGAGGAACAGG + Intronic
1142028043 16:87824848-87824870 GGGAAGTGTGGAGGAAAAACGGG - Intergenic
1142106876 16:88309094-88309116 GGAAAATCTGTGAGAAAACCGGG - Intergenic
1143591994 17:7890767-7890789 GAGAAATCTGCATTAAAGACGGG + Intronic
1146536273 17:33655314-33655336 GGGAAAACTGGAGGAGAAACAGG - Intronic
1149166083 17:53754215-53754237 TGGAAATGTGTATCAAAATCAGG - Intergenic
1150298895 17:64031984-64032006 TAGAAATCTGTAAGAAAACCTGG + Intergenic
1153867206 18:9282335-9282357 CTGAAATGTTTATGAAAAACAGG + Exonic
1154425160 18:14266288-14266310 AGGAAATCTGTTTGTATAACAGG + Intergenic
1154432853 18:14321527-14321549 AGGAAATCTGTTTGTATAACAGG + Intergenic
1155834640 18:30565812-30565834 GGCAAATATATATGAAACACTGG - Intergenic
1156105448 18:33653994-33654016 AGGAAATATGTAAGAAAAAGAGG - Intronic
1156169467 18:34464334-34464356 GGGAAATTTATATTAAAAAAAGG + Intergenic
1157536298 18:48460506-48460528 GGGAAAACTGTGTGAAAATCAGG + Intergenic
1159018521 18:63123002-63123024 ATGAAATGTGTATGAAAAAGAGG - Intergenic
1159049422 18:63405646-63405668 GAGAAATCCCTATTAAAAACTGG + Intronic
1159275105 18:66209012-66209034 GGAAAATTTGTTTTAAAAACTGG + Intergenic
1159299722 18:66547589-66547611 GGAAAATCTGTTGGAAAAAGAGG + Intronic
1162001967 19:7750619-7750641 GGGCAATTTGTAAGAAAAAGAGG + Intergenic
1163358608 19:16830720-16830742 GGGAAAGGTGTAAGAAAAATAGG - Intronic
1165555129 19:36624111-36624133 GTGAAAACTTTATGAAAAATCGG + Intronic
1167689454 19:50975888-50975910 GGGAATTCTGGGAGAAAAACAGG + Intergenic
925766210 2:7238050-7238072 AGGAAATCTGTATGAGAATTTGG + Intergenic
926524104 2:13954837-13954859 GAGAAATCTTTAGGAAAAAAAGG - Intergenic
927870307 2:26619004-26619026 GGGAATTCTGGATAAAGAACAGG - Intronic
928954362 2:36847639-36847661 AGCATATCTGTATGAAAATCAGG + Exonic
929896633 2:45966703-45966725 GGGAAAACTGTCAGAAAGACTGG - Intronic
930361285 2:50383299-50383321 GGTGAATCTGAATGGAAAACAGG - Intronic
935274541 2:101464630-101464652 TGGAAATTTGCCTGAAAAACGGG - Intronic
935718049 2:105955680-105955702 GGGAAATCTTTATGAAAGAAAGG - Intergenic
937582412 2:123502833-123502855 GGGACTACTGTATGACAAACAGG - Intergenic
937779194 2:125818289-125818311 TGGAAAACTGTAGAAAAAACAGG + Intergenic
939697127 2:145340456-145340478 AGGAAACCTATATGAAAATCTGG + Intergenic
941263796 2:163333368-163333390 GAGACATCTGAATAAAAAACTGG - Intergenic
942111378 2:172685913-172685935 TGGAAATGTGAATGCAAAACAGG - Intergenic
942509719 2:176685153-176685175 TGTTAATCTGGATGAAAAACGGG - Intergenic
942932134 2:181507522-181507544 GGCAAATGTATATGAAAATCAGG - Intronic
943165552 2:184320012-184320034 GGGAAGACTGTATGATTAACTGG + Intergenic
943206960 2:184911859-184911881 GGGAAAATTGTAGGAAAAAAAGG - Intronic
943541863 2:189225491-189225513 GGGAAATCTGTATTCAAATTTGG + Intergenic
944675193 2:202029568-202029590 GGGACATGTGTTTGGAAAACTGG + Intergenic
945383818 2:209173350-209173372 GAGAAATCTGTAAGAAATACAGG - Intergenic
945473317 2:210252448-210252470 GGGTAATCTTTATGAAAAAGGGG - Intergenic
945890985 2:215430858-215430880 GGGAAATTTGGAAGAAAAACAGG + Intronic
946651699 2:221898544-221898566 GGGAAATCCAAATGACAAACTGG - Intergenic
946731158 2:222710919-222710941 GGGAAATCTATTTGGAAGACAGG + Intergenic
946992928 2:225355916-225355938 GGTAAAATTCTATGAAAAACAGG + Intergenic
1169101676 20:2955627-2955649 GAGAAATCAGCTTGAAAAACTGG - Intronic
1169292387 20:4364004-4364026 TGAAAATCTGTTGGAAAAACTGG - Intergenic
1173237309 20:41258394-41258416 GGGACATCGGTAGAAAAAACCGG - Intronic
1173417344 20:42868810-42868832 GACAAAACTGTATGAAAAAAGGG + Intronic
1174544195 20:51313177-51313199 GGGAAATCTATAGTAAAAACAGG + Intergenic
1174658402 20:52191083-52191105 TGGAGATCTGAATGGAAAACGGG - Intronic
1177508319 21:22048409-22048431 AGGAAATATTTATGAAAAAAGGG - Intergenic
1179206101 21:39280621-39280643 GGGAAAGCTGACTGAAAAACTGG + Intronic
1179973565 21:44849989-44850011 GGGAAATCAGCCTGAAGAACTGG + Exonic
1180246473 21:46551601-46551623 GGGAACTCTGAATGAAAAGCTGG - Intronic
1182874598 22:33680130-33680152 GGGAACTCTGTGTTTAAAACTGG - Intronic
1182912327 22:33995195-33995217 GGGAAATTTATAAGAAAAAGAGG - Intergenic
950073826 3:10172975-10172997 GGCCAAACTCTATGAAAAACAGG + Intronic
950342628 3:12260817-12260839 GGGACATCTGAATGAAACATGGG + Intergenic
950808601 3:15629990-15630012 GGGAAATCTGTCTGAATTAAGGG - Exonic
951320688 3:21240885-21240907 GGAAAATATGTATCAAATACTGG + Intergenic
951617474 3:24564044-24564066 GGCAAATATGTATGATTAACAGG - Intergenic
952230842 3:31429127-31429149 GAGAAATAAGAATGAAAAACTGG - Intergenic
955068817 3:55555218-55555240 TGTAAATGTTTATGAAAAACGGG + Intronic
956223614 3:66931500-66931522 CGGAAATTTGCATGAAAAAAAGG - Intergenic
959012046 3:101089025-101089047 GAGAAATCTTCCTGAAAAACTGG + Intergenic
959154026 3:102644267-102644289 TGGAAATCTGTCAGAAAAATAGG - Intergenic
961596706 3:128023418-128023440 GGGAAATCAGTATGCAGAATTGG - Intergenic
962522442 3:136209869-136209891 GGGAACTCAGTAGGAAAAATAGG + Intergenic
962745465 3:138394688-138394710 GGGAAGTCTGGGTGAGAAACAGG - Intronic
963076088 3:141347573-141347595 GAGAAATCTGTTTGCAAAAGTGG - Intronic
965243549 3:166234227-166234249 GAGTAAGCTGTATGAAAAACTGG + Intergenic
966325815 3:178752598-178752620 TGGAAAACTGGAGGAAAAACTGG + Intronic
966723736 3:183089835-183089857 GGGAATTCTGTAAGAAATGCAGG + Intronic
969881449 4:10177559-10177581 GGGAGATCTCTATGACCAACTGG - Intergenic
970923326 4:21420594-21420616 GGGAAAGATGTATGAAACAGAGG - Intronic
971893649 4:32560915-32560937 GAAGAATCTGTAGGAAAAACAGG - Intergenic
973820256 4:54657203-54657225 GGAAAACGTGTATGAAAACCTGG + Intergenic
976547872 4:86358717-86358739 GGAAAATCTGTAAGTAAATCAGG - Intronic
978930399 4:114303817-114303839 GGTAAATGTGTATTAAAAAAGGG - Intergenic
979837442 4:125388895-125388917 AAGAAATATGTATGAATAACAGG - Intronic
980697089 4:136372544-136372566 GGGCAGTCTGTATAAAAAACAGG - Intergenic
981889344 4:149716711-149716733 GGGAAGTCTTTGTGAAGAACAGG - Intergenic
982565877 4:156986162-156986184 GGTAAATCACTTTGAAAAACTGG - Intergenic
983323042 4:166218419-166218441 TGGAAAACTATATGAAAAATTGG - Intergenic
984094854 4:175422152-175422174 GGCAAATCAGTATCAAAGACAGG - Intergenic
986377671 5:7148858-7148880 GAGAAAAGTGAATGAAAAACAGG + Intergenic
987459985 5:18197813-18197835 GGGAAATTAGCATGAATAACAGG + Intergenic
988990408 5:36664835-36664857 GGGAAATATGTTAGCAAAACAGG + Intronic
990120380 5:52443915-52443937 GGGGAATCTTTAAGAAAAACGGG - Intergenic
991315295 5:65296939-65296961 GTGGAAAATGTATGAAAAACTGG + Intronic
991480714 5:67076335-67076357 GAGAAAGCTGTGGGAAAAACTGG - Intronic
994867988 5:105302954-105302976 TGGAAATCCTTATGAAATACAGG - Intergenic
995218358 5:109620659-109620681 GGGAAATAACTATTAAAAACAGG - Intergenic
995546591 5:113238538-113238560 GGAAAATCTGTAAGCAAAATTGG - Intronic
995811872 5:116116111-116116133 GAGAAATCTACATGAAAAAATGG + Intronic
996761111 5:126986762-126986784 GAGGCACCTGTATGAAAAACTGG + Intronic
997961890 5:138328581-138328603 AGAAAATCTGAAGGAAAAACAGG - Intronic
998458914 5:142295036-142295058 AGGAAAGCTGTAGGAAAAGCAGG + Intergenic
998767790 5:145507514-145507536 GGAAAATCTGTTTGAAAAACTGG - Intronic
999377514 5:151097086-151097108 GGGAAATCTGTAGGAAACCCAGG + Intergenic
999665512 5:153909021-153909043 GGGAAAACTGCATGAAATCCTGG - Intergenic
999861209 5:155648492-155648514 GGGAAATCTTTCAGAGAAACTGG - Intergenic
1000939350 5:167341359-167341381 GGGATATCTGTGTGAAAGACAGG + Intronic
1001067962 5:168554840-168554862 GGGCAATCTTTAAGAAAAAATGG + Exonic
1005368368 6:25102867-25102889 GGGAAATGTGAATGAAAAAAAGG - Intergenic
1006998168 6:38282849-38282871 GGGGAATCAGGAGGAAAAACCGG - Intronic
1009044116 6:58216885-58216907 GGGAAATTTGTAGGGAAAATAGG + Intergenic
1009219941 6:60971153-60971175 GGGAAATTTGTAGGGAAAATAGG + Intergenic
1010088050 6:71944643-71944665 GGAGAATTTTTATGAAAAACAGG + Intronic
1011997294 6:93608413-93608435 GGGGAATCTGGATGAGAATCTGG + Intergenic
1012665679 6:101965373-101965395 TGGATATCTGAAAGAAAAACAGG - Intronic
1012726341 6:102815789-102815811 GGGCAATTTGTAAGAAAAAGAGG + Intergenic
1012768664 6:103400942-103400964 GGGAAATTTTTGTTAAAAACTGG - Intergenic
1014164651 6:118209897-118209919 GGGCAATCTATATGACAAAAAGG + Intronic
1014306161 6:119745169-119745191 GGGAAATCAGTATTATAAAGTGG - Intergenic
1016768254 6:147819382-147819404 GGTAAATCTGTGTCAAAACCTGG - Intergenic
1017168843 6:151436485-151436507 GGGAAATCTGTCTCAAGATCTGG - Exonic
1018490047 6:164283164-164283186 GGGAAGACTGCAGGAAAAACAGG - Intergenic
1019362589 7:612615-612637 GGGAAAAGTGAATGAAAAAACGG + Intronic
1019685696 7:2380727-2380749 AGCAAACTTGTATGAAAAACCGG + Exonic
1020250072 7:6460409-6460431 GTGACATCTGTTTGAAAAGCTGG - Intronic
1021175448 7:17444693-17444715 GGGAAAAATGTTTTAAAAACTGG - Intergenic
1021183395 7:17534364-17534386 GGAAAATCATTAAGAAAAACAGG + Intergenic
1021470225 7:20994143-20994165 GGTAACTCTGGGTGAAAAACTGG + Intergenic
1021783418 7:24129316-24129338 AGGGAATCTGTAAGAAAAAGAGG + Intergenic
1023167130 7:37354010-37354032 GGGAGATCTTTAAGAGAAACTGG - Intronic
1024910338 7:54440580-54440602 TGGATATCTGTAGGTAAAACAGG - Intergenic
1025526219 7:61815056-61815078 AGGAAAGCTATCTGAAAAACCGG + Intergenic
1028407615 7:90493241-90493263 GCAAAATCTGGATGAGAAACAGG + Intronic
1031264395 7:119566014-119566036 GTGAAATATGAAAGAAAAACTGG + Intergenic
1031376329 7:121031056-121031078 AGGAAATCTGTATGATATTCTGG - Intronic
1031708436 7:125012823-125012845 GTGAAATATGTATGTAAAAAAGG - Intergenic
1035162827 7:156963536-156963558 GGGAAGTCTGGATGAAAAATGGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035935894 8:3838077-3838099 GGGAAAGCTGTAGCAGAAACTGG + Intronic
1037197617 8:16210326-16210348 GAAAAATCTATATCAAAAACAGG - Intronic
1038480632 8:27899421-27899443 AGGAAATGTTTCTGAAAAACAGG + Intronic
1039312134 8:36328173-36328195 GGGAAAACTGTAAGAAAATTTGG - Intergenic
1039981109 8:42410702-42410724 GGAAAATCGGTATGTAAAATAGG - Intergenic
1045171136 8:99669814-99669836 GAGAAAACTGTATTCAAAACAGG - Intronic
1046537076 8:115529112-115529134 AGGAAATGTACATGAAAAACTGG + Intronic
1047963661 8:130029344-130029366 TGGAAATCTGTATTTTAAACAGG - Intergenic
1050197035 9:3096200-3096222 GAGTAATATTTATGAAAAACTGG + Intergenic
1050222772 9:3413170-3413192 GGGAAATTTGGATTAAAAGCTGG - Intronic
1051106524 9:13587116-13587138 GGAAAATCAGTATGTAAAACTGG + Intergenic
1051599746 9:18861188-18861210 GGGAAATGTGTATCAAAAGAGGG - Intronic
1052069454 9:24064330-24064352 TGCAAAACTGGATGAAAAACTGG + Intergenic
1052748085 9:32461078-32461100 GGGAAATCAGTCTGAATAACAGG + Intronic
1054852411 9:69861579-69861601 GGGAGAGCTATCTGAAAAACAGG - Intronic
1055766611 9:79670464-79670486 GGCATATCTGTCTGTAAAACAGG - Intronic
1057288355 9:93779494-93779516 GAGGAATCTGTATTAAATACAGG + Intergenic
1059108296 9:111530829-111530851 GAGGAATCTGTATGAACGACTGG + Intronic
1059715511 9:116909469-116909491 GGGAAAACTGTGGGAGAAACAGG + Intronic
1060244096 9:121929507-121929529 AAGGAATATGTATGAAAAACGGG + Intronic
1060310046 9:122451767-122451789 GGGAAATGTGTATGAGAAAATGG - Intergenic
1186091867 X:6057416-6057438 CGGACAGCTGGATGAAAAACTGG + Intronic
1187166468 X:16808874-16808896 GGTATATGTGTAGGAAAAACTGG + Intronic
1188323372 X:28768487-28768509 TGAAAAACTGTATGAGAAACTGG + Intronic
1190017865 X:46843602-46843624 GGCAAATCTGGATGAACAAAGGG + Intronic
1191691833 X:63947495-63947517 TGGAAATATATATGAAAATCAGG + Intergenic
1193006859 X:76628894-76628916 GTAAAACCTGTATGGAAAACAGG + Intergenic
1193631820 X:83899051-83899073 GGGAAGGCTGCAAGAAAAACTGG + Intergenic
1194337301 X:92664297-92664319 GGAAAAATTGTATGCAAAACAGG + Intergenic
1194688234 X:96951099-96951121 GGGAAATCTATATGAAAAAGAGG - Intronic
1195080177 X:101363069-101363091 GAGAAATCAGTATTAAAAGCTGG - Intronic
1195723735 X:107891942-107891964 GGGAACTCTGGATGACAAAAGGG - Intronic
1198731326 X:139733129-139733151 GAGGACTCTGTAGGAAAAACAGG - Intronic
1198972197 X:142294485-142294507 GTGAAATCTGTTCTAAAAACCGG - Intergenic
1201571169 Y:15415956-15415978 GGGGAATCTGGATTCAAAACAGG - Intergenic