ID: 923485954

View in Genome Browser
Species Human (GRCh38)
Location 1:234431714-234431736
Sequence TGCAGTAAATGAGACACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 532}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923485947_923485954 10 Left 923485947 1:234431681-234431703 CCCACATCAACTCTATAATCCCC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 923485954 1:234431714-234431736 TGCAGTAAATGAGACACAGAGGG 0: 1
1: 0
2: 4
3: 57
4: 532
923485948_923485954 9 Left 923485948 1:234431682-234431704 CCACATCAACTCTATAATCCCCA 0: 1
1: 0
2: 4
3: 25
4: 253
Right 923485954 1:234431714-234431736 TGCAGTAAATGAGACACAGAGGG 0: 1
1: 0
2: 4
3: 57
4: 532
923485951_923485954 -10 Left 923485951 1:234431701-234431723 CCCATTTTGCAGGTGCAGTAAAT No data
Right 923485954 1:234431714-234431736 TGCAGTAAATGAGACACAGAGGG 0: 1
1: 0
2: 4
3: 57
4: 532
923485950_923485954 -9 Left 923485950 1:234431700-234431722 CCCCATTTTGCAGGTGCAGTAAA 0: 1
1: 1
2: 5
3: 64
4: 564
Right 923485954 1:234431714-234431736 TGCAGTAAATGAGACACAGAGGG 0: 1
1: 0
2: 4
3: 57
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923485954 Original CRISPR TGCAGTAAATGAGACACAGA GGG Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
901798971 1:11696267-11696289 TAAAGTAAATGGGACACAGAAGG - Intronic
902247604 1:15131495-15131517 TGAAGAAACTGAGGCACAGAAGG + Intergenic
903093803 1:20949477-20949499 TGAAGAAACTGAGACACACAAGG + Intronic
903184426 1:21621321-21621343 AACAGTAAATGAGACTCAAAAGG + Intronic
903638448 1:24837908-24837930 TGGAGTAAAGGAGAAGCAGAGGG - Intronic
904267800 1:29327587-29327609 TGGAGAAACTGAGGCACAGAGGG - Intergenic
904941310 1:34166259-34166281 TGGAGTAGACGAGACAGAGACGG - Intergenic
905462599 1:38131492-38131514 TGAGGAAACTGAGACACAGAGGG + Intergenic
906687411 1:47771586-47771608 TGCACAAAAGGAGAAACAGAAGG + Intronic
906822744 1:48946513-48946535 TGCAGAAACTGAGGCACAGAGGG - Intronic
907558276 1:55364523-55364545 TGCAGAAAGAGAGGCACAGATGG - Intergenic
908287492 1:62623164-62623186 TTCCCTAAATGAGACACAGAAGG - Intronic
908397983 1:63743753-63743775 TGGGGGAATTGAGACACAGAGGG + Intergenic
908519433 1:64926825-64926847 TGAAGAAATTGAGGCACAGATGG - Intronic
910117489 1:83748394-83748416 TGTGGTAAATGAGCCCCAGAAGG - Intergenic
910752610 1:90650286-90650308 TGAGGAAACTGAGACACAGAGGG + Intergenic
910945059 1:92581941-92581963 AGCAGTAAATAAGACAAACAAGG + Intronic
911715912 1:101132894-101132916 TGAAATAAATCAAACACAGAAGG + Intergenic
912807805 1:112771786-112771808 TGAAGAAACTGAGGCACAGAAGG + Intergenic
912842063 1:113047626-113047648 TGAAGAAAATGAGGCACAGAGGG + Intergenic
913429378 1:118773663-118773685 TGAAGAAACTGAGACACATAAGG - Intergenic
913441559 1:118903843-118903865 TGCAGTAAATGTTACACTGAAGG + Intronic
913461538 1:119091355-119091377 TGAAGGAACTGAGGCACAGAAGG + Intronic
914696608 1:150088335-150088357 TGAAATAAATCAGACACAGAAGG - Intronic
914701532 1:150138378-150138400 AACAGCAAATGAGACAGAGAAGG - Intronic
914963549 1:152229375-152229397 AGCAATAAATGAGAAAGAGAAGG + Intergenic
915822823 1:159043270-159043292 TGCAGTAACAGAGAGACAGTGGG - Intronic
917733631 1:177900797-177900819 TGCAGAAACAGAGACAAAGAAGG + Intergenic
917759839 1:178144071-178144093 GTCAGTAAATGAGACAGAGAGGG - Intronic
918425900 1:184409414-184409436 TGCAGAAAATGACCCACAGGTGG + Intronic
918482379 1:184992407-184992429 TGAAATAAGTCAGACACAGAAGG - Intergenic
919032771 1:192265971-192265993 TGATGAAAATGAGACACAGAAGG - Intergenic
919367140 1:196676014-196676036 TACCGTGAATGTGACACAGATGG + Exonic
919656750 1:200204148-200204170 TGAAATAAACCAGACACAGAAGG + Intergenic
919928031 1:202202771-202202793 TGCCGAGAATGAGACCCAGAGGG + Intronic
920447521 1:206030106-206030128 TGAGGTAATTGAGGCACAGAGGG + Intergenic
920637647 1:207719819-207719841 TGTAGAAACTGAGACACAGAGGG + Intronic
921384225 1:214552536-214552558 TGGAGTTAATGAGACGCAGCTGG + Intergenic
921703831 1:218297117-218297139 TAAAGAAACTGAGACACAGAAGG + Intronic
921779318 1:219142799-219142821 TGCAGTAGAGGAGAGAGAGAAGG + Intergenic
922075993 1:222245198-222245220 AGCATTCAATGAGACAAAGAAGG + Intergenic
922547533 1:226469675-226469697 TGAAGTAAGGCAGACACAGAAGG - Intergenic
923485954 1:234431714-234431736 TGCAGTAAATGAGACACAGAGGG + Intronic
924596742 1:245452190-245452212 TGAAATAAATCAGACACAAAAGG - Intronic
1063022432 10:2143261-2143283 TGCAGTGAATGAGTGACAGCTGG + Intergenic
1063022436 10:2143300-2143322 TGCAGTGAATGAGTGACAGCCGG + Intergenic
1063022441 10:2143339-2143361 TGCAGTGAATGAGTGACAGCCGG + Intergenic
1064141278 10:12792615-12792637 TGCAGTATCTGAGAAGCAGATGG + Intronic
1064154453 10:12892082-12892104 TGAAGTGAAGGAGACAAAGAAGG - Intergenic
1064368296 10:14728015-14728037 GGCAGTGAATAAGAGACAGAGGG - Intronic
1065444607 10:25785590-25785612 TGCACTAAAGGATAAACAGATGG - Intergenic
1065469155 10:26059355-26059377 CCCAGTAAATGAGCCACAGAAGG - Intronic
1065537911 10:26732611-26732633 TCGAGAAACTGAGACACAGACGG - Intronic
1066229739 10:33420781-33420803 TGGAGTAAATGACACCCAGATGG + Intergenic
1066553705 10:36587425-36587447 GGCAGCAAAAGAGAAACAGAAGG + Intergenic
1067553650 10:47252985-47253007 TGGGGAAAATGAGGCACAGAAGG + Intergenic
1068088909 10:52408597-52408619 TGAAGAAAATGAGGCACAAAAGG - Intergenic
1068200434 10:53776838-53776860 TGGAGTACATATGACACAGAAGG + Intergenic
1068780444 10:60913937-60913959 TGCCGTAACTGACACACTGATGG + Intronic
1070165849 10:73897326-73897348 TGCAATAAGCCAGACACAGAAGG - Intergenic
1070523738 10:77276989-77277011 GCCAGTAAATGACACACAGCGGG + Intronic
1070744802 10:78927318-78927340 TGCAGTGCATGGCACACAGAGGG + Intergenic
1070853335 10:79585129-79585151 TGCAATAAACGAAACACAAATGG - Intergenic
1071704340 10:87981110-87981132 TGAAGAAACTGAGGCACAGAGGG - Intergenic
1071800325 10:89053229-89053251 TGAAGAAACTGAGACTCAGATGG - Intergenic
1073511737 10:104046775-104046797 TGCAGAAAATCAGACACAAGAGG + Intronic
1073662633 10:105493708-105493730 AGCAATATATGACACACAGAAGG - Intergenic
1073805440 10:107092759-107092781 TGCAGGACTTGAGAAACAGAAGG + Intronic
1073866504 10:107810471-107810493 TGAAATAAATCAGACACAGAAGG - Intergenic
1074114648 10:110446650-110446672 TGGAGAAACTGAGTCACAGAAGG + Intergenic
1074120897 10:110493988-110494010 TGTTGTGAAGGAGACACAGATGG + Intergenic
1076106368 10:127826858-127826880 TGCAGAAACTGAGACACGGTGGG - Intergenic
1076297471 10:129397717-129397739 TGCAGGACATGCGACACAGTGGG - Intergenic
1077448407 11:2615977-2615999 TGAAGAAAATGCTACACAGATGG - Intronic
1078319852 11:10324595-10324617 TTTAGGGAATGAGACACAGAAGG - Intronic
1078849043 11:15147352-15147374 TGCAGAAAATGAGATACAGCAGG - Intronic
1079167803 11:18063068-18063090 TAAAGTAACTGAGACTCAGATGG + Intergenic
1079338831 11:19595476-19595498 TGAGGAAACTGAGACACAGAGGG + Intronic
1079979140 11:27130903-27130925 TCCTGGAAAGGAGACACAGAAGG + Intergenic
1080307803 11:30855250-30855272 AGCAGAAAATGTGACACAAAGGG - Intronic
1080310206 11:30881301-30881323 TGCAGCAGCTGAGACACAGAGGG + Intronic
1081108597 11:39103608-39103630 TGAAGTCACTGAGACATAGAGGG + Intergenic
1081316172 11:41633271-41633293 TGAAATAAATCAGGCACAGAAGG - Intergenic
1081444047 11:43112732-43112754 TGTAATAAATCAGACACAGAAGG - Intergenic
1082061373 11:47863331-47863353 TGCTCTAAATCAGAAACAGATGG - Intergenic
1082801335 11:57416997-57417019 TGCAAAAAATGAGGCTCAGAAGG - Intronic
1082988768 11:59189420-59189442 TGCAGAAATTGAGGCACAGAGGG - Intronic
1085004906 11:73078549-73078571 TGAAAGAAATCAGACACAGAAGG + Intronic
1085238395 11:75032489-75032511 TGCAGAAAATGATAGAGAGACGG + Intergenic
1085253963 11:75161872-75161894 TGCAGTGAGTGAGATACTGATGG + Intronic
1085355182 11:75830159-75830181 TGCAGTATCTGATACCCAGAAGG - Intronic
1085476157 11:76790172-76790194 TGGAGAAACTGAGGCACAGAAGG + Intronic
1085561528 11:77476307-77476329 TGCGGGAACTGAGGCACAGAGGG + Intergenic
1085810280 11:79673815-79673837 TACAGTAACTTACACACAGAAGG - Intergenic
1086053022 11:82616360-82616382 TGCAGTAGATCAGAAGCAGAAGG - Intergenic
1086668254 11:89512530-89512552 TGAAATAAATCAGTCACAGAAGG - Intergenic
1086724309 11:90163614-90163636 TGAGGTAAATAAGACAAAGAAGG + Exonic
1086740737 11:90364945-90364967 TGCAGTTATTGAGAGGCAGATGG + Intergenic
1088799699 11:113294178-113294200 TGCACTCAGTGAGGCACAGAGGG - Intergenic
1088929577 11:114337621-114337643 CTCAGTAAATGAGAAATAGAGGG + Intergenic
1090855936 11:130609438-130609460 TGGAGAAAATAAGACACACAGGG + Intergenic
1091650941 12:2309223-2309245 TGAAATAAACCAGACACAGAGGG + Intronic
1091767614 12:3132029-3132051 TGCAGGAAGCCAGACACAGAAGG - Intronic
1092721874 12:11449225-11449247 TGGAGAAAATGAGGCAAAGAGGG - Intronic
1093427025 12:19039114-19039136 TGCAGTAAATCAGAAAAACATGG - Intergenic
1093963962 12:25305418-25305440 AGCAGTTAATCAAACACAGAGGG + Intergenic
1095748985 12:45690215-45690237 TCCAGCAAAAGAGACAAAGATGG + Intergenic
1097182411 12:57178933-57178955 TGTAGTTGATGAGACACAGGTGG - Exonic
1097260433 12:57716754-57716776 TTCAGTAAAGGAGACATGGAAGG - Intronic
1097388567 12:58980724-58980746 TGCATTAAAAAAGACAAAGATGG + Intergenic
1097823636 12:64152852-64152874 AGCTGTGAATGAGACACACAGGG + Exonic
1097942329 12:65324828-65324850 TGTACTAAATGACATACAGATGG + Intronic
1098154924 12:67588096-67588118 TGCAGTAACTGAGAGACAAATGG + Intergenic
1098258441 12:68642642-68642664 TGTAGAATATGAGAAACAGATGG - Intronic
1098302994 12:69073409-69073431 TGCATTTAATGAGACACATGAGG - Intergenic
1100104258 12:91149416-91149438 TTCAGTAAATCAGAAATAGAAGG + Intronic
1100364284 12:93904878-93904900 TGGAGAAAATAAAACACAGAAGG - Intergenic
1100458690 12:94777250-94777272 TGCAGAAACTGAGATACAGGGGG + Intergenic
1100683520 12:96958103-96958125 TGAAGTATATGAGACATAGGGGG - Intergenic
1100782181 12:98039004-98039026 AGCAATAAAGGAGAAACAGAAGG + Intergenic
1101282379 12:103271586-103271608 AGGAGTAAATGAGACAGAGTAGG + Intronic
1102186865 12:110955846-110955868 TCAAGAAACTGAGACACAGAGGG + Intergenic
1102724551 12:115049406-115049428 TGAAGAAACTGACACACAGAAGG + Intergenic
1103094326 12:118120751-118120773 TGCAGAAAGGAAGACACAGAAGG - Intronic
1103210950 12:119166014-119166036 TGCAGAAACTGAGGCACAGACGG + Intergenic
1103257000 12:119550443-119550465 TGAAGAAACTGAGACACAGAGGG + Intergenic
1103939003 12:124491882-124491904 TGGAGAGAATGAGGCACAGAGGG + Intronic
1104396017 12:128433884-128433906 TGCAGTACAAAAGACAGAGATGG + Intronic
1104490552 12:129189970-129189992 GGCAGAAAATGAGAATCAGAGGG + Intronic
1104592367 12:130094814-130094836 TGAAAGAAATCAGACACAGAAGG + Intergenic
1105402472 13:20107981-20108003 AGAAGTAAAGGAGACAGAGAGGG - Intergenic
1105881719 13:24611942-24611964 CTCTGTAAATGAGGCACAGATGG - Intergenic
1106982180 13:35300429-35300451 TGAAGTAAATGAGATACACACGG - Intronic
1107132035 13:36907118-36907140 TGCAATAAGCCAGACACAGAAGG + Intronic
1107904646 13:45050895-45050917 GCCAGTAAAGGAGACAGAGAAGG - Intergenic
1107943525 13:45396469-45396491 GGCAGTTAATTAGACACTGAAGG - Intronic
1108533027 13:51345190-51345212 TGGAGAAACTGAGGCACAGAAGG + Intronic
1109858406 13:68164445-68164467 TGCACGAAATCAGACACAGAGGG + Intergenic
1111138125 13:84078154-84078176 TGAAATAAGTGAGACACAAAAGG + Intergenic
1111467554 13:88635948-88635970 TCCAGTGAAATAGACACAGAAGG - Intergenic
1111472338 13:88699387-88699409 TTCAATAAATTAGGCACAGAAGG - Intergenic
1111912939 13:94331996-94332018 TGCAATGACTGAGACTCAGATGG - Intronic
1111999966 13:95201015-95201037 TTCAGTAAAGGAGAAACAAATGG - Intronic
1112127292 13:96481997-96482019 TGGAGTTAATGAAGCACAGAAGG - Intronic
1113718761 13:112535047-112535069 TGAAGTAAGCCAGACACAGAAGG - Intronic
1114274848 14:21133709-21133731 TGCACTAAAGATGACACAGAAGG - Intergenic
1114319105 14:21532172-21532194 TGCAATAAAGCAGACACAAAAGG + Intronic
1114741328 14:25100857-25100879 TTCACCAAAGGAGACACAGATGG + Intergenic
1114942522 14:27632005-27632027 TGAGGTGAATGAGACACATAAGG - Intergenic
1115041403 14:28933609-28933631 TGAAGTAAGTCAGACACAGAAGG - Intergenic
1115263959 14:31481816-31481838 TGAAGTAAGTCAGACACAAAAGG + Intergenic
1116433985 14:44876563-44876585 TGAGCTAAATGAGACACCGAGGG + Intergenic
1117142157 14:52800049-52800071 TGAAGGAAATGATACAAAGAGGG - Intergenic
1117225064 14:53649262-53649284 TGCAGAAAATGAGCAACAAAAGG + Intergenic
1117372440 14:55090867-55090889 TACAGTTGAGGAGACACAGAGGG + Intergenic
1117665578 14:58052815-58052837 TGAGGTACATGAGACACTGAAGG - Intronic
1117885498 14:60357204-60357226 TGCAGTAAAGAAGAAACAAATGG - Intergenic
1118503773 14:66388867-66388889 TGCAGCAAATGGGACAGTGATGG + Intergenic
1118508314 14:66441419-66441441 TGAAATAAACCAGACACAGAAGG + Intergenic
1118915003 14:70095420-70095442 TGGAGAAACTGAGGCACAGAAGG - Intronic
1119112885 14:71991472-71991494 TGTTTTAATTGAGACACAGAGGG - Intronic
1119382225 14:74236560-74236582 TGAAGAAACTGAGGCACAGAGGG + Intergenic
1120129054 14:80783406-80783428 TGAAGCAATTGGGACACAGAAGG - Intronic
1120358580 14:83465128-83465150 TACACTAAATTAGAAACAGAGGG - Intergenic
1121041920 14:90756724-90756746 TGCAGTGACTGAGACAGACATGG + Intronic
1121632188 14:95429538-95429560 TCCTATAAATGAGCCACAGATGG + Intronic
1121670565 14:95707597-95707619 TGAAATAAATCAGTCACAGAAGG + Intergenic
1122047837 14:99036101-99036123 TGCTCTAAATGAGAAACAGGCGG - Intergenic
1202844867 14_GL000009v2_random:159833-159855 TAAAGTAAATCAGTCACAGAAGG + Intergenic
1202914269 14_GL000194v1_random:150074-150096 TAAAGTAAATCAGTCACAGAAGG + Intergenic
1202878399 14_KI270722v1_random:32623-32645 TAAAGTAAATCAGTCACAGAAGG - Intergenic
1123829748 15:24122861-24122883 TGCAGCAAATGAGGCAGATAAGG - Intergenic
1123844707 15:24287119-24287141 TGCAGCAAATGAGGCAGATAAGG - Intergenic
1123859813 15:24453484-24453506 TGCAGCAAATGAGGCAGATAAGG - Intergenic
1124067839 15:26362869-26362891 TGCACTGAATGGAACACAGAAGG + Intergenic
1124390588 15:29252958-29252980 GGCTGTAAATGAAACACAGTTGG - Intronic
1124985583 15:34608793-34608815 TGCAGTGAAAGAGACACAACAGG + Intergenic
1125076441 15:35624277-35624299 TGCAGAAATTAAGATACAGAAGG + Intergenic
1125449989 15:39798213-39798235 TGCAGAAAGTGAGTCAGAGAAGG + Intergenic
1126511595 15:49481394-49481416 TGCAGTAAAGGAAGCACAAAGGG - Intronic
1127336753 15:57994038-57994060 TGCAGTAATTGAGCCAGAGCTGG + Intronic
1127975263 15:63992419-63992441 ATCAGTAAATGAGAGACAGATGG - Intronic
1128533940 15:68475757-68475779 TGTAGTAAGAGAGACAGAGATGG - Intergenic
1128797190 15:70474533-70474555 GGCAGGAAATGAGGCTCAGATGG + Intergenic
1129502506 15:76053346-76053368 TGAAGAAACTGAGGCACAGAGGG - Intronic
1130895771 15:88169472-88169494 GGCAGCAAATGAGGCACACAGGG + Intronic
1132427226 15:101728158-101728180 AGCATTAAATAAGACAAAGAAGG + Intergenic
1133711947 16:8409855-8409877 TGAGGAAAATGAGGCACAGAGGG - Intergenic
1133723747 16:8518616-8518638 TGAAGTAAGTCAGACACAAAAGG + Intergenic
1134098386 16:11434759-11434781 TGGAGAAACTGAGGCACAGAAGG + Intronic
1134361102 16:13531928-13531950 ATCACTAAATGAGACAAAGAAGG - Intergenic
1135545663 16:23364438-23364460 TGTAGGGAATGAGACATAGAAGG + Intronic
1135718033 16:24789929-24789951 TGAAGTAAGTGGTACACAGAAGG + Exonic
1135838422 16:25850477-25850499 TGAAGTAACTTAGACATAGAGGG - Intronic
1136029962 16:27495699-27495721 TGCAGAAAATAAAGCACAGATGG + Intronic
1136602684 16:31305630-31305652 TTCAATAAATTAGACATAGAAGG - Intronic
1137349599 16:47700964-47700986 TGAAATGAATGAGACACAGTTGG + Intronic
1137915527 16:52425939-52425961 TGTAGCAAATGAAATACAGAAGG + Intergenic
1138267715 16:55671823-55671845 TGCAGGAAACGAGAGACAGAGGG + Intronic
1138444705 16:57056091-57056113 TGAGGGAACTGAGACACAGAGGG + Intronic
1138502617 16:57457204-57457226 TCCAAGAACTGAGACACAGATGG - Intronic
1138514751 16:57529780-57529802 TGCAGTGATGGAGACACATAAGG - Intronic
1139404046 16:66704318-66704340 AGGACTAAATGAGACACTGAGGG - Intergenic
1140121697 16:72089296-72089318 TGCAGTGAATGAGACTCTGGAGG - Intronic
1141178581 16:81737110-81737132 TGAAGTAAACCAGACACAGAAGG - Intergenic
1141288117 16:82691534-82691556 AGTAGTAAGTGAGACAGAGAAGG - Intronic
1141294664 16:82756389-82756411 TGCAGTAAGTGATCCACAAATGG - Intronic
1141296713 16:82776478-82776500 TGTAGTAAATGGGACACAAAGGG + Intronic
1141920372 16:87131792-87131814 TGAAGAAACTGAGGCACAGAGGG + Intronic
1142296387 16:89225610-89225632 AGCATCAAATGAGACACAGACGG + Exonic
1142362403 16:89633644-89633666 TGGGGAAACTGAGACACAGAGGG + Intronic
1142362413 16:89633710-89633732 TGGGGAAACTGAGACACAGAGGG + Intronic
1142967189 17:3588991-3589013 TGCAAGAAATGAGAGCCAGATGG + Intronic
1143321911 17:6073920-6073942 TGCAGAATCTGAGACAGAGAAGG - Intronic
1143955703 17:10666937-10666959 TATAGAAAATGATACACAGAAGG + Intergenic
1145025604 17:19465855-19465877 TGGGGTTAATGAGACTCAGAAGG - Intergenic
1145264863 17:21374906-21374928 TGAAGGAACTGAGGCACAGAGGG - Intergenic
1145767230 17:27467094-27467116 TGAAGAAACTGAGGCACAGAGGG + Intronic
1147556345 17:41481577-41481599 TGCAGCCAGGGAGACACAGAAGG + Intergenic
1148076690 17:44941081-44941103 TGAAGAAATTGAGACAGAGAGGG + Intronic
1148147076 17:45372778-45372800 TGCGGGAACTGAGGCACAGAAGG - Intergenic
1149005418 17:51800232-51800254 TGCAGGAAAACAGACACAAACGG + Intronic
1149011638 17:51863070-51863092 TGAAGTAAATGAGATTTAGAGGG - Intronic
1149115567 17:53091242-53091264 TCCAGCAAATGAGACAGAAAAGG + Intergenic
1149623219 17:58061437-58061459 TGAAGTAACTGAGGCACAGAGGG + Intergenic
1150014943 17:61545206-61545228 CTCAGTAAATTAGAAACAGAGGG - Intergenic
1150890801 17:69147089-69147111 TGCTTGAAATCAGACACAGAAGG - Intergenic
1151501714 17:74494277-74494299 TGAAGAAACTGAGACCCAGATGG - Intergenic
1151578844 17:74966487-74966509 TGCAGGAAGTGACACTCAGAAGG - Intronic
1152440370 17:80304969-80304991 TGAAATAAATCAGACACAAAAGG - Intronic
1152796232 17:82308884-82308906 TCCAATAAATGAGAAAGAGAGGG - Intergenic
1153610788 18:6882583-6882605 TGTAGTAACTGAGGCTCAGAAGG - Intronic
1153868586 18:9296228-9296250 TGAAGAAACTGAGGCACAGAGGG + Intergenic
1155753928 18:29465968-29465990 TGCTCTATATGAGACATAGAGGG - Intergenic
1155863550 18:30935107-30935129 TGCAATAAATGAAAGACTGAAGG - Intergenic
1156356136 18:36342103-36342125 AACAGAAAATTAGACACAGATGG + Intronic
1156574280 18:38296263-38296285 TGTAGAAGATGAGATACAGATGG + Intergenic
1157285484 18:46374520-46374542 TGAAATAAACCAGACACAGAAGG - Intronic
1157382667 18:47234115-47234137 TCCAGTAAAAGATACACAAAAGG - Intronic
1157693952 18:49705831-49705853 TGAAGTAAGCGAGACACAAAAGG - Intergenic
1157896501 18:51473672-51473694 TGCTGTGAATCAGACAGAGAGGG - Intergenic
1158050067 18:53207160-53207182 TGCAGTAAATGAGATACTGGAGG - Intronic
1158804503 18:60953413-60953435 TTCAGTAAATTAGACACTGAAGG + Intergenic
1159149859 18:64506914-64506936 TGAAATAAACCAGACACAGAAGG - Intergenic
1160463682 18:79058107-79058129 TGCAATAAGCTAGACACAGAAGG - Intergenic
1162223232 19:9197451-9197473 TGAAGTAAATAAATCACAGAAGG + Intergenic
1162610341 19:11745049-11745071 TGAAATAAGTCAGACACAGAAGG + Intergenic
1163173842 19:15551028-15551050 TGAAGGAACTGAGACTCAGAGGG + Intronic
1163206934 19:15810397-15810419 TGAAAGAAATGAGACACAAAAGG - Intergenic
1164299652 19:23950479-23950501 TGGCATAAATGTGACACAGATGG + Intergenic
1164552302 19:29221884-29221906 TGCAGTCAGTGAGACCCTGAGGG + Intergenic
1164560662 19:29289862-29289884 TGGGGAAAATGAGACTCAGAGGG - Intergenic
1164969767 19:32521699-32521721 TGCAATAAATACGACAGAGAAGG - Intergenic
1165987002 19:39778166-39778188 TGGAGTAAATGAGTAACAGAGGG + Intronic
1166165148 19:40982514-40982536 TGGAGAAAGTGAAACACAGAGGG - Intergenic
1166798686 19:45443297-45443319 GGCAGTAACTGGGACACAGCCGG + Intronic
1166872561 19:45879638-45879660 TGGAGCAAATGAGACAGAAACGG - Intergenic
1167115127 19:47484601-47484623 TGAAGGAATTGAGGCACAGAGGG + Intergenic
1167238487 19:48329328-48329350 TGCAGTAAGGAGGACACAGAGGG - Intronic
1167692081 19:50991866-50991888 TGAACCAAATGAGACTCAGAGGG - Intergenic
1168136094 19:54352856-54352878 TGTAGAAAAAGAGACAAAGACGG + Exonic
1202654020 1_KI270708v1_random:1671-1693 TAAAGTAAATCAGTCACAGAAGG - Intergenic
1202672278 1_KI270710v1_random:308-330 TAAAGTAAATCAGTCACAGAAGG + Intergenic
925590924 2:5508104-5508126 TGCAGCAAAGAAGACAGAGACGG - Intergenic
926003407 2:9352648-9352670 TGCAGTAACTCACACCCAGAAGG - Intronic
926017538 2:9467981-9468003 TGTATTAAATGAAACACAAACGG - Intronic
926692271 2:15745754-15745776 TGGAGAAACTGAGGCACAGAGGG + Intergenic
926969160 2:18449724-18449746 TGGGGTAAGTGAGGCACAGATGG - Intergenic
927260227 2:21081098-21081120 TGAAGTAAAGGAGACAGAAAAGG + Intergenic
928240660 2:29582755-29582777 TGCAGAGAAAGAGACAGAGACGG + Intronic
929010076 2:37433128-37433150 AGCAGTAAAAAAGACAAAGAAGG - Intergenic
929382946 2:41374058-41374080 TGGAGTAAATCATACAAAGAAGG + Intergenic
930156069 2:48108870-48108892 TGAAGAAACTGAGTCACAGAAGG + Intergenic
930464443 2:51728953-51728975 TGCAGGAAATGATAAACTGAAGG - Intergenic
931056705 2:58480485-58480507 TGAAGAAACTGAGGCACAGAAGG - Intergenic
931123518 2:59247904-59247926 CCTAGTAAGTGAGACACAGAGGG + Intergenic
931270327 2:60696137-60696159 TGCAATAAATTAGAAACAAATGG - Intergenic
931413240 2:62055229-62055251 TGCAGGAAAAGAGGCCCAGATGG - Intronic
931512065 2:63009597-63009619 TACAGTAAATGAATCACATAAGG - Intronic
931942059 2:67263032-67263054 TGAAGTAAGTGAGACACAGGAGG - Intergenic
932061656 2:68506598-68506620 TGAAGAAATTGGGACACAGAAGG + Intronic
932200499 2:69822646-69822668 TGCAATAAATCAGACACAAACGG + Intronic
932675233 2:73774639-73774661 TGAAATAAACCAGACACAGAAGG - Intronic
933272149 2:80244522-80244544 TGAAGTAACTTAGACTCAGATGG + Intronic
933432478 2:82200977-82200999 TGTAGTATATGAGAGACAGAAGG - Intergenic
933885288 2:86714105-86714127 TGAAGAAATTGAGGCACAGAGGG - Intronic
933924888 2:87082578-87082600 TGAAGAAATTGAGGCACAGAGGG + Intergenic
934605436 2:95691692-95691714 TGCAGTGAATCAGACAGGGAAGG + Intergenic
935159504 2:100517205-100517227 TGAAGAAACTGAGGCACAGAAGG - Intergenic
935257278 2:101321930-101321952 TGCTGTAAGTGTGACACACACGG - Intergenic
935279611 2:101506179-101506201 TGCAGGAAAGGGGACTCAGAAGG + Intergenic
935951010 2:108328681-108328703 TGAAGAAATTGAGATACAGAGGG + Intergenic
937260128 2:120580110-120580132 TGGAGAAAGTGAGACCCAGAGGG - Intergenic
937521948 2:122722284-122722306 AGCAGTTAAAGAGACAAAGAGGG + Intergenic
938929926 2:136077732-136077754 TGAAGCAAATGACACAGAGAGGG - Intergenic
939235218 2:139483136-139483158 TGCAGTGCATAAGACAAAGAAGG - Intergenic
940654226 2:156469085-156469107 TGAAATAAATAAGGCACAGAAGG - Intronic
941714012 2:168745059-168745081 TGAAGCATATGAGACACAGGTGG + Intronic
942196269 2:173523587-173523609 TTCAGTGAAAGAGCCACAGAGGG - Intergenic
942394935 2:175537118-175537140 TGCAGGAGATGAGAGACACAAGG + Intergenic
942565229 2:177259545-177259567 GGCAGAAACTGACACACAGAAGG + Intronic
944406106 2:199385485-199385507 TGCAGAAAATAAGAGACTGAGGG - Intronic
944516659 2:200519121-200519143 TGCATTAAATGAGACAAAGGAGG + Intronic
944617155 2:201473086-201473108 TGAAGAAAATGATACACAGTTGG + Intronic
945037077 2:205713367-205713389 AGGAATAAATGAGACACAGTAGG - Intronic
945512285 2:210717429-210717451 TGCAATAAAAGACACAAAGAAGG + Intergenic
946530263 2:220563196-220563218 TGAAATAAGTCAGACACAGAAGG + Intergenic
946924458 2:224612746-224612768 TCACGTAAATGAGACACAGCTGG + Intergenic
948372694 2:237500159-237500181 TCCAGCAAAGGAGACAGAGAAGG - Intronic
1170033704 20:11968627-11968649 CTGAGTAAATGAGACACTGATGG - Intergenic
1170054222 20:12181755-12181777 TGAAATAAACCAGACACAGAAGG + Intergenic
1170557433 20:17526006-17526028 TACAGTATTTGGGACACAGAAGG - Intronic
1171101293 20:22385684-22385706 TGCAATAAATGACCCTCAGATGG - Intergenic
1171115698 20:22523127-22523149 TGCAGTAAGTGAAGCACAGAGGG - Intergenic
1172591058 20:36118197-36118219 TTCATTAAATAAAACACAGATGG + Intronic
1172595835 20:36150621-36150643 TGAAGTAACTGAGGCTCAGAAGG - Intronic
1173359459 20:42328457-42328479 TGCAGTAAATGATCCACTTATGG - Intronic
1173472025 20:43331544-43331566 TGAAGAAACTGAGGCACAGAAGG + Intergenic
1173580723 20:44144788-44144810 TACATGAAATGAGACATAGAAGG + Intronic
1174040416 20:47695540-47695562 TGAAATAAACCAGACACAGAAGG - Intronic
1174404224 20:50293279-50293301 TGGAGAAACTGAGGCACAGAGGG + Intergenic
1174667883 20:52277242-52277264 TGCAGTAAAAGGCACACAGTAGG + Intergenic
1175478225 20:59292085-59292107 TGCAGAAACCGAGACTCAGAAGG - Intergenic
1175799863 20:61795471-61795493 TGGCGTAAATGAGACACTCAGGG + Intronic
1176633624 21:9164749-9164771 TAAAGTAAATCAGTCACAGAAGG + Intergenic
1176639705 21:9290065-9290087 TAAAGTAAATCAGTCACAGAAGG - Intergenic
1177000903 21:15611467-15611489 TTCAGTAAACTAGAAACAGAGGG + Intergenic
1177087151 21:16720160-16720182 AGCAGAAAATGAGCCAGAGAGGG - Intergenic
1178091304 21:29166264-29166286 TGAAATAAGTGAGGCACAGAAGG - Intronic
1178130449 21:29565877-29565899 GACAGCAAATGACACACAGAAGG + Intronic
1180348716 22:11779445-11779467 TAAAGTAAATCAGTCACAGAAGG - Intergenic
1180373002 22:12062900-12062922 TAAAGTAAATCAGTCACAGAAGG - Intergenic
1180389484 22:12212755-12212777 TAAAGTAAATCAGTCACAGAAGG + Intergenic
1180416457 22:12721720-12721742 TAAAGTAAATCAGTCACAGAAGG - Intergenic
1180423751 22:12897533-12897555 TAAAGTAAATCAGTCACAGAAGG - Intergenic
1182987036 22:34729557-34729579 TGAAGCAAGTCAGACACAGAAGG + Intergenic
1183090903 22:35521158-35521180 TGAGGAAACTGAGACACAGATGG - Intergenic
1183150208 22:36030882-36030904 TGAAGAAACTGAGACACAGAGGG - Intergenic
1183946250 22:41327452-41327474 GGGAGGAAGTGAGACACAGAAGG - Intronic
1184052611 22:42019287-42019309 TGTAGAAAATGAGGAACAGACGG - Intronic
1184110565 22:42391536-42391558 GGCAGTGATTGAAACACAGATGG + Intronic
1184177624 22:42798021-42798043 TGAAGGAATTGAGGCACAGAAGG - Intronic
949183848 3:1167232-1167254 TGCAGTATGTAAGACAGAGAGGG - Intronic
950310336 3:11952466-11952488 TTAAGAAACTGAGACACAGATGG - Intergenic
950515568 3:13462791-13462813 TGCAGCAAATCAGACATTGAAGG - Intergenic
950644945 3:14371524-14371546 TGCAGAAACAGAGACACACAGGG - Intergenic
950770946 3:15310557-15310579 TGCAGAAAATGAGCCATGGAGGG + Intronic
951785214 3:26411357-26411379 TGAAAAAACTGAGACACAGATGG - Intergenic
951926710 3:27915763-27915785 AGAAGTAAATGAGACAGATAAGG + Intergenic
952422051 3:33141449-33141471 TCAAGTACATGAGACACAAATGG - Intronic
952585007 3:34881583-34881605 TGCAGTAAGTAAGCCTCAGATGG - Intergenic
952667775 3:35927893-35927915 TGCAAAAACTGTGACACAGAAGG + Intergenic
953497644 3:43402315-43402337 GGCAGAAGATGAGACCCAGAGGG - Intronic
954932096 3:54293057-54293079 TGAAATAAATCAGACACAAAAGG + Intronic
955962360 3:64353773-64353795 TGTAGAAACTGAGACTCAGAGGG + Intronic
956004830 3:64767547-64767569 TGGGGAAAATGAGACCCAGAGGG - Intergenic
956066603 3:65403105-65403127 TGGAGAAACTGAGACAGAGAGGG - Intronic
956590055 3:70905193-70905215 TGTAGTACATGAGAGACAGAAGG + Intergenic
957100495 3:75820741-75820763 TAAAGTAAATCAGTCACAGAAGG + Intergenic
957402641 3:79736055-79736077 TTAAGTAAATGAGGCAGAGAAGG + Intronic
957753159 3:84449469-84449491 TGCAGTAATTGGGGCAGAGAGGG + Intergenic
960146251 3:114206938-114206960 TGAAATAAATCAGACACAAAAGG - Intergenic
960734401 3:120762472-120762494 TGCATCAAAAGAGACAAAGAAGG - Intronic
960946960 3:122973626-122973648 TGCAGTAAGTGAAACAGTGAAGG + Intronic
961315597 3:126033314-126033336 TGCAGTCCATGAGACAGAGAAGG + Intronic
961443787 3:126968581-126968603 TTCAGTAGATGAAACACAAAGGG - Intergenic
961658786 3:128457498-128457520 TGCAGAAACTGAGGCTCAGAGGG - Intergenic
962298002 3:134211277-134211299 TGCAGAAAAAGAGACAGGGAGGG + Intronic
962898990 3:139740769-139740791 TGAAATAAATGAGACAGTGATGG + Intergenic
963026913 3:140928836-140928858 TGAAATAAATCAGACACAAAAGG - Intergenic
963389880 3:144647515-144647537 TGAAATAAGTCAGACACAGAAGG + Intergenic
963437876 3:145294740-145294762 TGCAGATAAAGAAACACAGATGG - Intergenic
963746037 3:149126062-149126084 TCCAGTAAAGGAGACAGAGGAGG + Intergenic
964122239 3:153196922-153196944 TCCAGTAAAGGGGACAGAGATGG + Intergenic
964883917 3:161458457-161458479 TGAAATAAATCAGTCACAGAAGG + Intergenic
967156369 3:186696217-186696239 TGCAGGAAATGCTGCACAGAGGG - Intergenic
967165385 3:186775211-186775233 TGAAATAAACCAGACACAGAAGG - Intergenic
967276993 3:187785708-187785730 TGAAGAAACTGAGACACACAAGG + Intergenic
968293083 3:197554230-197554252 TGCAGTTACAGAGGCACAGAAGG - Intronic
1202747189 3_GL000221v1_random:114963-114985 TAAAGTAAATCAGTCACAGAAGG + Intergenic
968432470 4:566877-566899 TGCAGTGGGTGAGACACAGTGGG - Intergenic
969185645 4:5472270-5472292 TGCCGTGAATCAGACACACAGGG + Intronic
969475688 4:7421414-7421436 TGCAGTAAACCAGGCTCAGAGGG - Intronic
969494780 4:7520327-7520349 TGCAGTCAGTGAGACACAGTTGG + Intronic
969545197 4:7821543-7821565 TGCAGCAAATAAGACAGACAAGG + Intronic
969989051 4:11241568-11241590 TACACTGAATGGGACACAGAAGG + Intergenic
970969571 4:21965909-21965931 TGGAATAAAAGAGACACAGGAGG - Intergenic
971738890 4:30495443-30495465 TGGAGGAATTCAGACACAGAAGG + Intergenic
972011232 4:34184905-34184927 TGAAATAAATCAGTCACAGAAGG - Intergenic
972224901 4:37001671-37001693 TTAAATAAATGAGACACAGAAGG + Intergenic
972331489 4:38068219-38068241 TTCAGATAATGAGACACAAATGG - Intronic
972641074 4:40925385-40925407 TGAAGAAACTGAGGCACAGAGGG + Intronic
973981320 4:56310469-56310491 AGCACTACCTGAGACACAGAGGG - Intronic
977165010 4:93683964-93683986 TGCAGTAGAGGAGAGACATAAGG + Intronic
977324685 4:95560370-95560392 TGCAGCAAAGGAGACCTAGAAGG + Intergenic
978985924 4:115012936-115012958 TGAAGTAAGCTAGACACAGAAGG + Intronic
980165659 4:129223781-129223803 TGAAGTAAAAGAGATAGAGAGGG + Intergenic
982099461 4:151953866-151953888 TACAGAACATGAGCCACAGAGGG - Intergenic
982385091 4:154792463-154792485 TTCAATGAATGAGACACGGAAGG - Intronic
982714418 4:158791748-158791770 CACAGGAAATGAAACACAGAGGG - Intronic
982737874 4:159025020-159025042 TGGTGTAACTGAGACACAGAAGG + Intronic
983502355 4:168513518-168513540 TGAAGAAACTGAGTCACAGAGGG - Intronic
984190396 4:176598628-176598650 AGGAATAATTGAGACACAGAAGG + Intergenic
985041101 4:185892653-185892675 TGAAGTAAGCCAGACACAGAAGG + Intronic
985233513 4:187848140-187848162 TGCAATGAGTGAGACACAAAAGG - Intergenic
1202754592 4_GL000008v2_random:48459-48481 TAAAGTAAATCAGTCACAGAAGG - Intergenic
985812604 5:2101014-2101036 TGCAGTAAGCCAGACACAGAAGG + Intergenic
986536682 5:8794947-8794969 TGAAATAAACCAGACACAGAAGG - Intergenic
986571812 5:9173522-9173544 TCCACTATGTGAGACACAGAAGG - Intronic
986826356 5:11526967-11526989 TGAAGTAAGCCAGACACAGAAGG + Intronic
987379241 5:17269323-17269345 TGTAGGAAGTGAGACTCAGAAGG + Intronic
987724862 5:21684916-21684938 TGCAGCAAAAAAGACACAAATGG + Intergenic
988013728 5:25526467-25526489 TGAAATAAATCAGTCACAGAAGG + Intergenic
988394786 5:30682956-30682978 CACAGTAAATAAGACACACATGG + Intergenic
988848598 5:35156181-35156203 TGGAGTAAATGAGAGAGAGAGGG - Intronic
988987363 5:36633783-36633805 TTAAGTAAATGAGACTGAGATGG - Intronic
990002152 5:50906982-50907004 CCCAGCAAATGAGACAGAGAAGG + Intergenic
990017675 5:51085230-51085252 TGCAGAAAAAAAGACTCAGATGG - Intergenic
990427447 5:55700871-55700893 AGCAGCAAAGGAGACAGAGAAGG - Intronic
990755525 5:59065215-59065237 TGGAATAAACCAGACACAGAAGG + Intronic
991343107 5:65633601-65633623 TTCAGAAAATGAATCACAGAGGG - Intronic
991596780 5:68314661-68314683 TGAAGAAACTGAGTCACAGAGGG - Intergenic
992472153 5:77068757-77068779 AGCAGTGAATAAGACAAAGAAGG - Intergenic
993403588 5:87484009-87484031 TGAAATAAATCAGACACAAAAGG - Intergenic
994147830 5:96414204-96414226 TGAAGAAACTGAGGCACAGAGGG - Intronic
994179435 5:96747876-96747898 TGAGGAAATTGAGACACAGAGGG + Intronic
994448433 5:99908323-99908345 TGCAGTATCTAAGACTCAGAGGG + Intergenic
995616859 5:113974232-113974254 TCCAGTAAAGAAGACAGAGAAGG + Intergenic
996824613 5:127667790-127667812 TTTTTTAAATGAGACACAGAGGG - Intergenic
997398350 5:133582249-133582271 TGCAGTGCACGAGACACAAAGGG + Intronic
997521967 5:134528695-134528717 TGCAGCAAATGCCTCACAGAGGG + Intronic
997600606 5:135135892-135135914 TGCAGGAGATGAGGTACAGATGG + Intronic
997710713 5:136001747-136001769 TGAAGTCAACGAGAAACAGATGG - Intergenic
998358608 5:141563976-141563998 AGCAGAAACTGAGACAGAGATGG + Intronic
998384090 5:141746174-141746196 TGCAGTACATGACACACGGGGGG + Intergenic
998593384 5:143501624-143501646 TGCTGTAAATAGGAAACAGATGG + Intergenic
999120746 5:149207402-149207424 GGCAGTAAATGAGAGACGGCCGG - Intronic
999698225 5:154204899-154204921 AGCAGTAAATAAGACACACAAGG - Intronic
1000240865 5:159406855-159406877 TGCAGTAAAGGGGGCACTGAGGG - Intergenic
1000383680 5:160652149-160652171 AGCAGGAAAGGAGACACAGCAGG - Intronic
1001208935 5:169792106-169792128 TGATGTAAATGAGAGACAGTGGG + Intronic
1001242474 5:170081034-170081056 TGGAGTAAATGAAATAAAGAAGG - Intronic
1001254197 5:170171213-170171235 TGCAGTAGAAGAGACAGACAGGG - Intergenic
1002676173 5:180915010-180915032 TGCATTAAGTGAGACAGAAATGG - Intronic
1003452150 6:6244966-6244988 TGGAGAAACTGAGTCACAGAGGG + Intronic
1003891140 6:10564840-10564862 AGTAGTGAATGAGACACATAAGG + Intronic
1004174194 6:13324784-13324806 TGCAAAAAATGAGTCCCAGAGGG + Intronic
1004478835 6:15999813-15999835 TGAAGAAACTGAGACTCAGAAGG + Intergenic
1004690904 6:17991231-17991253 AGGAGAAAATGAGACAGAGAAGG - Intergenic
1005259901 6:24047649-24047671 TTCAGTAAATGAGACAGACAAGG + Intergenic
1005764535 6:28998130-28998152 TGCAGTAACTGACACACAGAAGG + Intronic
1006105374 6:31713252-31713274 TGCAGGAAAAGAAACAGAGATGG + Intronic
1006433897 6:34015937-34015959 TGAAGAAAATGAGGCCCAGAGGG + Intergenic
1007258711 6:40546912-40546934 TGAAGAAACTGAGACTCAGAAGG - Intronic
1007734413 6:43971794-43971816 GGCAGTAATTGAGAAAAAGAGGG + Intergenic
1007768273 6:44174018-44174040 AGCAGTGAATGAGACAAAGAAGG - Intronic
1008085467 6:47239591-47239613 TGAAGTACATGCCACACAGATGG - Intronic
1008563538 6:52745205-52745227 TGGAGTAAATGAGACACCATAGG + Intergenic
1008765740 6:54912024-54912046 AGAAGAAAATGAGACAAAGAGGG - Intronic
1009352601 6:62701072-62701094 TCCAGAAAATTAGACACTGAAGG + Intergenic
1009571488 6:65390942-65390964 TGGACAAAATGAGATACAGAGGG + Intronic
1009855946 6:69263824-69263846 TGAAGAAACTGAGACATAGAGGG + Intronic
1009966922 6:70587671-70587693 TGAAGAAAATGAGCCACAAAGGG - Intronic
1010068060 6:71709189-71709211 TGCAGTGAAGGAGAGAAAGACGG - Intergenic
1010454647 6:76040718-76040740 CACAGAAAATGAGACACATAAGG + Intronic
1011014259 6:82737144-82737166 TGGAGTAAATGAGAGCCTGATGG + Intergenic
1012162329 6:95901433-95901455 TGAAATAAACCAGACACAGAAGG - Intergenic
1012257911 6:97055462-97055484 TGCAGTAGAGGAGAAACTGATGG - Intronic
1012753793 6:103197954-103197976 TGCAGTAAACCAGACCCAGGAGG + Intergenic
1013632010 6:111995039-111995061 TGAAATAAATCAGACACCGAAGG + Intergenic
1015178948 6:130341121-130341143 TGCTGTGAAAGAAACACAGAGGG + Intronic
1016085761 6:139912417-139912439 AGCAGTAAGTGAAACACACAAGG - Intergenic
1016179494 6:141126661-141126683 GGCAGAAAAAGAGAAACAGAGGG + Intergenic
1016379172 6:143456169-143456191 TGAAGAAATTTAGACACAGAGGG + Intronic
1016734897 6:147467381-147467403 TGAAGTTACTAAGACACAGAGGG - Intergenic
1016747770 6:147599270-147599292 GGCAGTAAAAGAGACAAACAGGG + Intronic
1016748428 6:147606270-147606292 TACAGTACATCAGACACAAAGGG - Intronic
1017458887 6:154630458-154630480 TACAGTCTATGAGACATAGAAGG + Intergenic
1017969386 6:159298607-159298629 TGGAGAAAAGGAGACAGAGAGGG - Intergenic
1018402963 6:163444306-163444328 TGAAGAAAATGAGACCCAGAAGG + Intronic
1019040975 6:169105018-169105040 TGAAATAAATGAGTCACAAAAGG + Intergenic
1020383355 7:7569670-7569692 TCCAGTAGAAGAGACAGAGATGG + Intronic
1020464868 7:8465914-8465936 TGCAGTACATGGGGGACAGAAGG - Intronic
1020482706 7:8681880-8681902 TGCAGTAAATGACGCACATATGG - Intronic
1021770278 7:23993443-23993465 TGAAATAAATCAGTCACAGAAGG - Intergenic
1021804172 7:24338809-24338831 TTCAGTAAATGGCACTCAGAAGG - Intergenic
1022943509 7:35260777-35260799 TGCAGAAAATGAAGCTCAGAAGG + Intergenic
1023782582 7:43670660-43670682 TGCACTAAAAGAGACATAGAGGG + Intronic
1024833057 7:53484295-53484317 TGCAGAAACTGAGACACAGAGGG - Intergenic
1026258196 7:68731250-68731272 TTGAGTAAATGAGGCACAGGAGG + Intergenic
1026592998 7:71712497-71712519 TGCAAGAGATGAGACACAGGAGG - Exonic
1028933120 7:96436451-96436473 GGGAGTAAAAGAGATACAGATGG - Intergenic
1031401224 7:121328355-121328377 TGCAGGAAATAAGACAAATAGGG + Intronic
1031405789 7:121385222-121385244 ACCAGAAAATGAGTCACAGAAGG + Intronic
1031838065 7:126703024-126703046 TGCGGAAAATGAGACACTGTGGG + Intronic
1031904222 7:127443093-127443115 TGTATTAAATAAGACTCAGAGGG - Intergenic
1032114901 7:129108643-129108665 TGGACTGAATGAGACAGAGATGG - Intergenic
1032642484 7:133785398-133785420 TACAGTAAATGAGACACACATGG - Intronic
1032797269 7:135288090-135288112 TGCGGTAGATGAGACAGAGAAGG - Intergenic
1032978103 7:137249125-137249147 TGGAATAAATGGGACACAGCAGG - Intronic
1033450864 7:141461374-141461396 AGCAGAAAATGTCACACAGATGG + Intronic
1034408908 7:150926965-150926987 AGCATTAAATGAGACACAGAAGG + Intergenic
1034775849 7:153825878-153825900 GACAGTAAGTTAGACACAGAAGG - Intergenic
1034822682 7:154231666-154231688 TGCAGGCATAGAGACACAGAAGG - Intronic
1035887915 8:3311612-3311634 TACAGGAAATGAAAAACAGATGG + Intronic
1036618785 8:10408824-10408846 TGAAATAACTCAGACACAGAAGG - Intronic
1037497577 8:19454700-19454722 ATCAGAAGATGAGACACAGAAGG + Intronic
1038196940 8:25377317-25377339 TGAAGCAAATGAGGCACACAGGG - Exonic
1038336227 8:26647840-26647862 TACAGTCACAGAGACACAGACGG + Intronic
1040710398 8:50181271-50181293 TGCAGGATCTGAGACACACAAGG - Intronic
1040823164 8:51587984-51588006 TGCAATAAATGAAATACACAGGG + Intronic
1040848020 8:51865645-51865667 CCCAATAAATTAGACACAGAGGG + Intronic
1042323961 8:67508588-67508610 GGCAGTGAGTGAGACCCAGATGG + Intronic
1043152930 8:76741158-76741180 TGCAGCAAATGCTATACAGAGGG + Intronic
1043218320 8:77624359-77624381 TGTAATAAATCAGTCACAGAAGG - Intergenic
1043955037 8:86349865-86349887 TGCAGAAAATGGGCCACAGATGG + Intronic
1044244832 8:89930772-89930794 GGCAGAAAAAGAGAAACAGATGG + Intergenic
1044354956 8:91210300-91210322 TGCAGGAAAAAAGAGACAGAAGG - Intronic
1044376466 8:91478999-91479021 TACTGTAAATGGCACACAGATGG - Intergenic
1044391337 8:91655572-91655594 TGAAATAATTCAGACACAGAAGG + Intergenic
1044415516 8:91934991-91935013 GGCAGTATTTGAGTCACAGATGG - Intergenic
1044573206 8:93742249-93742271 TGAAGAAACTGAGGCACAGAGGG - Intergenic
1045159175 8:99518147-99518169 TGCAGTAAATGAGGTAAATATGG - Intronic
1045230581 8:100302710-100302732 TCCAGTAAAGGAGACAGAAAAGG + Intronic
1045726856 8:105184244-105184266 TACAGTAAAAAAGACAAAGATGG - Intronic
1046751700 8:117933639-117933661 AGCAGTAAGTGAGACCAAGAAGG - Intronic
1047424433 8:124732367-124732389 TGAAGAAACTGAGGCACAGAAGG + Intergenic
1047716674 8:127602070-127602092 TGTGGAAAACGAGACACAGAAGG + Intergenic
1047831377 8:128634308-128634330 TGCAGTAAATGCTGCAAAGAGGG - Intergenic
1048812806 8:138304050-138304072 TGCTGTCAGTGAGACCCAGATGG + Intronic
1048928795 8:139294376-139294398 TGAAGTAAATCAGCTACAGAAGG + Intergenic
1050179084 9:2900448-2900470 TGTAGAATATGAGAAACAGAAGG - Intergenic
1050884639 9:10748711-10748733 TGCAATAAATGAAACTCAGAAGG + Intergenic
1051643426 9:19244838-19244860 TGAGGAAAATTAGACACAGATGG - Intronic
1051730641 9:20139324-20139346 TGCGGAAACTGAGGCACAGAGGG - Intergenic
1051939569 9:22489569-22489591 TTCAGTAAATGAGACAATTAGGG + Intergenic
1052247173 9:26349686-26349708 AGCAGTTAAAGAGACAAAGAGGG + Intergenic
1052319958 9:27157280-27157302 TGGAGTAAATGAGGCCCTGAGGG + Intronic
1053448786 9:38175212-38175234 TGAAGTAAGTCAGACACAAAAGG + Intergenic
1053583602 9:39433478-39433500 TGAAATAAATGAGACATAAAAGG - Intergenic
1053847791 9:42258332-42258354 TGAAATAAATGAGACATAAAAGG - Intergenic
1054105182 9:60992221-60992243 TGAAATAAATGAGACATAAAAGG - Intergenic
1055752788 9:79526154-79526176 TGAAGAAACTGAGACTCAGAAGG - Intergenic
1055996684 9:82167834-82167856 TGCAGAAAAGGAAACAAAGAGGG - Intergenic
1056109653 9:83382475-83382497 TGAAGAAATTGAGACACAGAGGG + Intronic
1056405638 9:86271774-86271796 TGAAGAAACTGAGGCACAGAGGG - Intronic
1056469835 9:86894637-86894659 TCTAGTAAATGATACACAGTGGG + Intergenic
1056989284 9:91395057-91395079 TGAAGAAACTGAGGCACAGAAGG + Intergenic
1057545570 9:96017971-96017993 TGAAATAAATCAGACACAGAAGG + Intergenic
1058547352 9:106074902-106074924 TGAAATAAGTCAGACACAGAAGG - Intergenic
1058782065 9:108347700-108347722 AGCAGAAAAGGAGACAGAGATGG - Intergenic
1059114333 9:111587219-111587241 ATCAGTAAATGAGACAGAAAGGG - Intronic
1059732950 9:117074875-117074897 TGAAGACCATGAGACACAGAGGG + Intronic
1059756153 9:117295433-117295455 GGCAGGAAATAAGACACACAAGG - Intronic
1059986036 9:119821558-119821580 CGCAGTCAATGAGACAGACATGG - Intergenic
1060013468 9:120065339-120065361 TGAGGTAACTGAGACCCAGAGGG + Intergenic
1060090347 9:120737240-120737262 TAAAATAAATTAGACACAGAAGG - Intergenic
1062158395 9:135066725-135066747 TGCAGGAAAGGAGACACATGTGG + Intergenic
1203756463 Un_GL000218v1:132378-132400 TAAAGTAAATCAGTCACAGAAGG + Intergenic
1203715825 Un_KI270742v1:145053-145075 TAAAGTAAATCAGTCACAGAAGG + Intergenic
1203535388 Un_KI270743v1:33178-33200 TAAAGTAAATCAGTCACAGAAGG - Intergenic
1203650075 Un_KI270751v1:108613-108635 TAAAGTAAATCAGTCACAGAAGG + Intergenic
1185756030 X:2653843-2653865 TGCAGAAAGAGAGACACAAAAGG + Intergenic
1186381053 X:9059478-9059500 TGAATGAAATGAGTCACAGAAGG + Intronic
1187183139 X:16962400-16962422 TAAAATAAGTGAGACACAGAAGG + Intronic
1187217369 X:17290082-17290104 TGGGGAGAATGAGACACAGAGGG + Intergenic
1189369188 X:40414294-40414316 TGGGGGAAATGAGACACGGAAGG + Intergenic
1190372902 X:49759850-49759872 TGAAGAAACTGAGGCACAGAGGG + Intergenic
1190454245 X:50610759-50610781 TGCAATAAATAAGACAAAGAAGG + Intronic
1190565595 X:51727379-51727401 TGCAATAAAACAGACAAAGAAGG - Intergenic
1190573774 X:51812515-51812537 TGGAAGAAGTGAGACACAGAAGG - Intronic
1190829548 X:54047663-54047685 TGCTGGAAATGAGTCACAGGAGG - Intronic
1191682999 X:63860334-63860356 TGAAATAAGTCAGACACAGAAGG - Intergenic
1194746430 X:97633566-97633588 AGTAGTGAATGAGACATAGAAGG + Intergenic
1195487964 X:105431952-105431974 TGCAGGAAATGAGATCCAGGTGG + Intronic
1196058631 X:111383973-111383995 TGAGGTAACTGAGACACAGAGGG + Intronic
1196236010 X:113281038-113281060 TGCAGTGAAGGAGACAAACAAGG + Intergenic
1196470610 X:116020492-116020514 TGCATAGAATGAGATACAGAGGG + Intergenic
1196934407 X:120715366-120715388 TGGGGTAATTGAGACATAGATGG - Intergenic
1196977031 X:121170065-121170087 TGAAATAAGTGATACACAGAAGG - Intergenic
1197122882 X:122913193-122913215 TGAAATAAATCAGTCACAGAAGG + Intergenic
1197132656 X:123022376-123022398 AGCAGTAAAAGAGAGAAAGAGGG + Intergenic
1197480408 X:126977455-126977477 TGCAGTAAATCAGCCACTGTTGG - Intergenic
1197504114 X:127280302-127280324 AGCAGTAAAAAAGACAAAGAGGG + Intergenic
1198392920 X:136194440-136194462 TGAAGTAAATGATTCGCAGAGGG + Intronic
1198641594 X:138761840-138761862 CGCAGTAAAGGAGACAAAGGAGG - Intronic
1198771465 X:140135257-140135279 TGAAGTAAATCAGTCACAAAAGG - Intergenic
1201170053 Y:11250002-11250024 TAAAGTAAATCAGTCACAGAAGG + Intergenic
1201220998 Y:11770146-11770168 TTCTGTTAATGAGAGACAGAGGG - Intergenic
1201624216 Y:15996408-15996430 TGAAATAAGTCAGACACAGAAGG + Intergenic
1202280332 Y:23178576-23178598 GGCAGTAAATAAGCCACAGCTGG + Intronic
1202284829 Y:23229096-23229118 GGCAGTAAATAAGCCACAGCTGG - Intronic
1202436503 Y:24843483-24843505 GGCAGTAAATAAGCCACAGCTGG - Intronic