ID: 923490413

View in Genome Browser
Species Human (GRCh38)
Location 1:234478914-234478936
Sequence GCTCCCGGAGGCGGCGCGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923490413 Original CRISPR GCTCCCGGAGGCGGCGCGCG AGG (reversed) Exonic