ID: 923495584

View in Genome Browser
Species Human (GRCh38)
Location 1:234521719-234521741
Sequence ATGGAGAAGCAGCAAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923495584_923495596 26 Left 923495584 1:234521719-234521741 CCTGCCCCTTGCTGCTTCTCCAT No data
Right 923495596 1:234521768-234521790 AGGAACAGCATGCCTCAGCTAGG No data
923495584_923495597 29 Left 923495584 1:234521719-234521741 CCTGCCCCTTGCTGCTTCTCCAT No data
Right 923495597 1:234521771-234521793 AACAGCATGCCTCAGCTAGGTGG No data
923495584_923495593 6 Left 923495584 1:234521719-234521741 CCTGCCCCTTGCTGCTTCTCCAT No data
Right 923495593 1:234521748-234521770 CATGGGATGCATGCCACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923495584 Original CRISPR ATGGAGAAGCAGCAAGGGGC AGG (reversed) Intergenic
No off target data available for this crispr