ID: 923495593

View in Genome Browser
Species Human (GRCh38)
Location 1:234521748-234521770
Sequence CATGGGATGCATGCCACCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923495583_923495593 22 Left 923495583 1:234521703-234521725 CCAGGTTCTCTTTTGGCCTGCCC No data
Right 923495593 1:234521748-234521770 CATGGGATGCATGCCACCTTAGG No data
923495584_923495593 6 Left 923495584 1:234521719-234521741 CCTGCCCCTTGCTGCTTCTCCAT No data
Right 923495593 1:234521748-234521770 CATGGGATGCATGCCACCTTAGG No data
923495585_923495593 2 Left 923495585 1:234521723-234521745 CCCCTTGCTGCTTCTCCATTCCT No data
Right 923495593 1:234521748-234521770 CATGGGATGCATGCCACCTTAGG No data
923495586_923495593 1 Left 923495586 1:234521724-234521746 CCCTTGCTGCTTCTCCATTCCTG No data
Right 923495593 1:234521748-234521770 CATGGGATGCATGCCACCTTAGG No data
923495587_923495593 0 Left 923495587 1:234521725-234521747 CCTTGCTGCTTCTCCATTCCTGC No data
Right 923495593 1:234521748-234521770 CATGGGATGCATGCCACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923495593 Original CRISPR CATGGGATGCATGCCACCTT AGG Intergenic
No off target data available for this crispr