ID: 923495596

View in Genome Browser
Species Human (GRCh38)
Location 1:234521768-234521790
Sequence AGGAACAGCATGCCTCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923495592_923495596 -2 Left 923495592 1:234521747-234521769 CCATGGGATGCATGCCACCTTAG No data
Right 923495596 1:234521768-234521790 AGGAACAGCATGCCTCAGCTAGG No data
923495591_923495596 2 Left 923495591 1:234521743-234521765 CCTGCCATGGGATGCATGCCACC No data
Right 923495596 1:234521768-234521790 AGGAACAGCATGCCTCAGCTAGG No data
923495584_923495596 26 Left 923495584 1:234521719-234521741 CCTGCCCCTTGCTGCTTCTCCAT No data
Right 923495596 1:234521768-234521790 AGGAACAGCATGCCTCAGCTAGG No data
923495590_923495596 7 Left 923495590 1:234521738-234521760 CCATTCCTGCCATGGGATGCATG No data
Right 923495596 1:234521768-234521790 AGGAACAGCATGCCTCAGCTAGG No data
923495585_923495596 22 Left 923495585 1:234521723-234521745 CCCCTTGCTGCTTCTCCATTCCT No data
Right 923495596 1:234521768-234521790 AGGAACAGCATGCCTCAGCTAGG No data
923495587_923495596 20 Left 923495587 1:234521725-234521747 CCTTGCTGCTTCTCCATTCCTGC No data
Right 923495596 1:234521768-234521790 AGGAACAGCATGCCTCAGCTAGG No data
923495586_923495596 21 Left 923495586 1:234521724-234521746 CCCTTGCTGCTTCTCCATTCCTG No data
Right 923495596 1:234521768-234521790 AGGAACAGCATGCCTCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923495596 Original CRISPR AGGAACAGCATGCCTCAGCT AGG Intergenic
No off target data available for this crispr