ID: 923500883

View in Genome Browser
Species Human (GRCh38)
Location 1:234562635-234562657
Sequence CCCACGAGGCCAGACAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923500876_923500883 6 Left 923500876 1:234562606-234562628 CCCCTTTGATCTAGAATCCATCT No data
Right 923500883 1:234562635-234562657 CCCACGAGGCCAGACAGGCCTGG No data
923500878_923500883 4 Left 923500878 1:234562608-234562630 CCTTTGATCTAGAATCCATCTGA No data
Right 923500883 1:234562635-234562657 CCCACGAGGCCAGACAGGCCTGG No data
923500875_923500883 12 Left 923500875 1:234562600-234562622 CCGAAACCCCTTTGATCTAGAAT No data
Right 923500883 1:234562635-234562657 CCCACGAGGCCAGACAGGCCTGG No data
923500877_923500883 5 Left 923500877 1:234562607-234562629 CCCTTTGATCTAGAATCCATCTG No data
Right 923500883 1:234562635-234562657 CCCACGAGGCCAGACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923500883 Original CRISPR CCCACGAGGCCAGACAGGCC TGG Intergenic
No off target data available for this crispr