ID: 923505214

View in Genome Browser
Species Human (GRCh38)
Location 1:234599964-234599986
Sequence TGCTCCAGAGAGCGCGCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923505207_923505214 25 Left 923505207 1:234599916-234599938 CCAGCAGGAGCCAGACCTTTTAC No data
Right 923505214 1:234599964-234599986 TGCTCCAGAGAGCGCGCCGGCGG No data
923505210_923505214 10 Left 923505210 1:234599931-234599953 CCTTTTACTTTATTTGGTTCACC No data
Right 923505214 1:234599964-234599986 TGCTCCAGAGAGCGCGCCGGCGG No data
923505209_923505214 15 Left 923505209 1:234599926-234599948 CCAGACCTTTTACTTTATTTGGT No data
Right 923505214 1:234599964-234599986 TGCTCCAGAGAGCGCGCCGGCGG No data
923505206_923505214 26 Left 923505206 1:234599915-234599937 CCCAGCAGGAGCCAGACCTTTTA No data
Right 923505214 1:234599964-234599986 TGCTCCAGAGAGCGCGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923505214 Original CRISPR TGCTCCAGAGAGCGCGCCGG CGG Intergenic