ID: 923505720

View in Genome Browser
Species Human (GRCh38)
Location 1:234604874-234604896
Sequence CGTCCACAAAGGCCACCCAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923505715_923505720 5 Left 923505715 1:234604846-234604868 CCCAGATCAACACTTTCCAGCTA 0: 1
1: 0
2: 0
3: 16
4: 138
Right 923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG 0: 1
1: 0
2: 0
3: 1
4: 115
923505714_923505720 13 Left 923505714 1:234604838-234604860 CCAGAAAACCCAGATCAACACTT 0: 1
1: 0
2: 2
3: 13
4: 194
Right 923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG 0: 1
1: 0
2: 0
3: 1
4: 115
923505716_923505720 4 Left 923505716 1:234604847-234604869 CCAGATCAACACTTTCCAGCTAC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG 0: 1
1: 0
2: 0
3: 1
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923505720 Original CRISPR CGTCCACAAAGGCCACCCAA AGG Exonic
900535754 1:3176372-3176394 CTTCCCCAAAGGCCACCTCAAGG - Intronic
901642956 1:10702310-10702332 GGTCCACAGAGGCCTCCCACTGG + Intronic
906509687 1:46403824-46403846 TGTCCACAAAGACCCCCCATGGG - Intronic
908392392 1:63695520-63695542 CTTCCAAAAAGGGCACCCTATGG - Intergenic
910573713 1:88735404-88735426 CTTCCACCTTGGCCACCCAAAGG + Intronic
913649474 1:120898288-120898310 CCTCCTCAAAGGCCACCTACAGG + Intergenic
914077210 1:144365223-144365245 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914101968 1:144601282-144601304 CCTCCTCAAAGGCCACCTACAGG + Intergenic
914171661 1:145230807-145230829 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914296935 1:146335919-146335941 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914639632 1:149592366-149592388 CCTCCTCAAAGGCCACCTACAGG + Intergenic
919067793 1:192714777-192714799 AGTCCAGAAATGCCATCCAAGGG - Intergenic
921821938 1:219627005-219627027 CATCTACAAGGGCCACTCAAGGG - Intergenic
923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG + Exonic
924591166 1:245406016-245406038 TTTGCACAAAGGCCACTCAAAGG + Intronic
1067039111 10:42939702-42939724 CCTCCACCACGGCCACCCAGAGG + Intergenic
1068904156 10:62304277-62304299 CGCCCACATCGGCCTCCCAAAGG - Intergenic
1069147855 10:64917912-64917934 GGTCCAGAAATGCCATCCAAGGG - Intergenic
1072614049 10:97037872-97037894 CCTCCACATAGGCCACACGATGG + Intronic
1076427333 10:130376879-130376901 CCTCCATAAAGGGCACACAAAGG - Intergenic
1077158256 11:1101101-1101123 TCCCCACAGAGGCCACCCAAGGG - Intergenic
1083172571 11:60931710-60931732 CCACCACAAAGTCCACCCATAGG - Exonic
1083350996 11:62028903-62028925 CGCCCACCACGGCCTCCCAAAGG + Intergenic
1084127449 11:67109266-67109288 CGCCCACCTTGGCCACCCAAAGG - Intergenic
1087915969 11:103811141-103811163 CCTCCACAGAGGCTTCCCAATGG + Intergenic
1089398004 11:118148395-118148417 GGTCCACAAAGGCCGCCGGAGGG + Intronic
1094419128 12:30252190-30252212 AATCCACAAAGGTCACACAAAGG - Intergenic
1101964203 12:109271221-109271243 CATCCACACAGGCCACAGAAAGG + Intergenic
1102581152 12:113888940-113888962 CGTCCAGAAGAGCCCCCCAAAGG - Intronic
1103841421 12:123868324-123868346 CATCCAGAAAGACCACCCAGAGG - Intronic
1108603178 13:52012037-52012059 TGTGCGCAAAGGCCAGCCAATGG + Intergenic
1110501319 13:76231563-76231585 GGTCCAGAAATGCCATCCAAGGG - Intergenic
1111131069 13:83976230-83976252 CATAAACAAAGGCCACCCTAAGG - Intergenic
1111527291 13:89489967-89489989 CGCCCACATTGGCCTCCCAAAGG - Intergenic
1113748949 13:112765304-112765326 CGTCCTCAGAGGCCTCCCCAAGG - Intronic
1122148586 14:99708784-99708806 CGCCCACATATGCCATCCAAGGG + Intronic
1122966022 14:105126414-105126436 AGTCCTCAAAGGTCACCCCACGG - Intergenic
1132309874 15:100849701-100849723 GCTCCACACAGGCCACCGAACGG + Intergenic
1134597467 16:15507391-15507413 CATCCCCAAATGCCACCCCAGGG - Intronic
1137598105 16:49738213-49738235 CGGCCTCAAAGCCCACACAAAGG + Intronic
1139909184 16:70386579-70386601 CGCCCACATCGGCCTCCCAAAGG + Intronic
1140240954 16:73199726-73199748 CATCCACCATGGCCTCCCAAAGG - Intergenic
1141154466 16:81587607-81587629 GGCCGCCAAAGGCCACCCAATGG + Intronic
1141443000 16:84041555-84041577 CGTCCACCTTGGCCTCCCAAAGG + Intronic
1142045547 16:87922868-87922890 AGGCCACAGAGGCCTCCCAATGG - Intronic
1142291053 16:89193699-89193721 CCTCCACCAGGGCCACCCGAGGG + Intronic
1143093592 17:4464436-4464458 TGACCACAAAGCCCACCTAAGGG - Intronic
1143651763 17:8267607-8267629 CGCCCACGAAGGCCACGCCACGG - Exonic
1147604072 17:41764042-41764064 TGTCCACAAATGCCACGCAGAGG + Intronic
1151588029 17:75022986-75023008 CATCGTCAAAGGACACCCAAAGG + Intergenic
1153258515 18:3197923-3197945 AGTCCACAAAGGCAAGCCATTGG - Intronic
1157335737 18:46736288-46736310 AGTACACAAAGGGCACACAATGG + Intronic
1160210629 18:76875101-76875123 CGTCCACAACCACCACCCCAGGG - Intronic
1164237658 19:23351079-23351101 CGTCCACCTCGGCCTCCCAAAGG - Intronic
1165212714 19:34248609-34248631 GCACCACAAAGGCCACCAAAAGG + Intergenic
1165720039 19:38072698-38072720 CCTCTCCAATGGCCACCCAATGG - Intronic
927909780 2:26889047-26889069 GGTTCACAAAGGCCTCCCAAAGG + Intronic
930963376 2:57288670-57288692 CACCCACAAAGGCCACTTAATGG - Intergenic
936966918 2:118135835-118135857 CGTCCTCAAAGGCCAGGAAAAGG - Intergenic
937559526 2:123205268-123205290 GGTCCAGAAATGCCATCCAAGGG + Intergenic
941162975 2:162055935-162055957 CATCCACACTGGCCACCCAGTGG + Intronic
942077263 2:172367303-172367325 CGTCAACAGAGTTCACCCAATGG + Intergenic
946882288 2:224188469-224188491 CTTTCATAAAGGCCACACAATGG + Intergenic
1169082269 20:2804910-2804932 CCTCCAGAAAGACAACCCAAGGG + Intergenic
1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG + Intronic
1170545919 20:17435866-17435888 CATCCACAAAGGCCTCTCCAGGG - Intronic
1177666557 21:24167293-24167315 CATCCACAATAGCCACCAAAAGG - Intergenic
1178588147 21:33886864-33886886 GGTACAAAAATGCCACCCAAAGG - Intronic
1181427214 22:22851492-22851514 CGTGCCCAAAGACCACCCACAGG + Intronic
1183979638 22:41532004-41532026 AGGCCCCAAAGGCCACCCTAAGG + Intronic
1184287162 22:43478182-43478204 CGTTCAAAAAGGCCACTGAATGG - Intronic
1184791875 22:46705102-46705124 CTCCCATAAAGGCCACCCACGGG - Intronic
1185182811 22:49372893-49372915 CCTCCAGCAGGGCCACCCAATGG - Intergenic
951101784 3:18696657-18696679 CTGCCACCAAGGCCACCAAATGG + Intergenic
952203116 3:31151559-31151581 GGTCCAGAAATGCCAGCCAAAGG + Intergenic
953458161 3:43060529-43060551 AATCAACAAAGACCACCCAAGGG - Intergenic
962467671 3:135675220-135675242 CGTCCACAGAGGTGAGCCAAGGG + Intergenic
964518148 3:157534773-157534795 TGTTCACAAAGGCCACCAGAGGG + Intergenic
965723586 3:171688780-171688802 CTCCCACAAAGGCCACCGATTGG + Exonic
968120302 3:196121283-196121305 TTTCCCCAAAAGCCACCCAAAGG - Intergenic
974627864 4:64446918-64446940 CGTGCAGAAAGCCCACCCTAGGG + Intergenic
974829210 4:67169963-67169985 CGCCCACCTAGGCCTCCCAAAGG - Intergenic
974893240 4:67907238-67907260 GGTCCAGAAATGCCATCCAAGGG + Intergenic
978676684 4:111327018-111327040 GGTCCAGAAATGCCATCCAAGGG + Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985806770 5:2050810-2050832 CGTGCACAAAGGCCACACTTGGG + Intergenic
989980760 5:50641584-50641606 CCTCCTCAAAGGCCACCTACAGG + Intergenic
990283243 5:54274232-54274254 CAACCAGAAGGGCCACCCAAGGG + Intronic
998380474 5:141721399-141721421 CTTTCAGAAAGGGCACCCAAGGG + Intergenic
1007202676 6:40123424-40123446 TGTCCTCTAAGCCCACCCAAAGG - Intergenic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1018278689 6:162161173-162161195 TATCCACAAAGGCCAGCCATGGG + Intronic
1018316578 6:162562419-162562441 GGTCCAGAAATGCCATCCAAGGG - Intronic
1020519967 7:9173270-9173292 GGTCCAGAAATGCCATCCAAGGG + Intergenic
1023029169 7:36078164-36078186 TGTGCACACAGCCCACCCAAGGG - Intergenic
1023098882 7:36692242-36692264 CGTCTACTAAGGCCACCACAGGG + Intronic
1023517705 7:41018260-41018282 GCTCCAGAAAGGCCACCAAAGGG + Intergenic
1029836619 7:103318965-103318987 CGTCCGCATTGGCCTCCCAAAGG - Intronic
1030035021 7:105401643-105401665 TGTCCACCTAGGCCTCCCAAAGG + Intergenic
1045299481 8:100898949-100898971 GGGCCATAAAGGCCACACAAAGG + Intergenic
1045558353 8:103236759-103236781 CTGCCACACAGGCCATCCAAGGG - Intergenic
1047526510 8:125638564-125638586 CATCCACCAAGGCTACTCAAGGG - Intergenic
1047666855 8:127101172-127101194 CGTCCACCTCGGCCTCCCAAAGG + Intergenic
1052599325 9:30604318-30604340 CTTCCACAAATGCCTCCCATTGG + Intergenic
1055114605 9:72593292-72593314 CTTCCACCATGGCCTCCCAAAGG - Intronic
1057225215 9:93289371-93289393 TGTCCACAAAGCCCACCCTGGGG - Exonic
1062209130 9:135353750-135353772 CGGGCACAAAGGTGACCCAAAGG + Intergenic
1188132373 X:26452975-26452997 CTTTCTCAAAAGCCACCCAATGG - Intergenic
1193194841 X:78619615-78619637 GGTCCAGAAATGCCATCCAAGGG + Intergenic
1194274795 X:91865922-91865944 GGTCCAGAAATGCTACCCAAGGG + Intronic
1194285666 X:92007531-92007553 GGTCCAGAAATGCCACCTAAGGG + Intronic
1195855463 X:109327404-109327426 CGTCCACAATTGCCACAAAAAGG - Intergenic
1198925583 X:141788233-141788255 GGTCCACAAATGCCATCCGAGGG + Intergenic
1200009393 X:153109722-153109744 CGTGCAGAAAGCCCACCCTAAGG + Intergenic
1200030207 X:153290200-153290222 CGTGCAGAAAGCCCACCCTAAGG - Intergenic
1200592037 Y:5087323-5087345 GGTCCAGAAATGCTACCCAAGGG + Intronic
1200603230 Y:5232070-5232092 GGTCCAGAAATGCCACCTAAGGG + Intronic