ID: 923505720

View in Genome Browser
Species Human (GRCh38)
Location 1:234604874-234604896
Sequence CGTCCACAAAGGCCACCCAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923505715_923505720 5 Left 923505715 1:234604846-234604868 CCCAGATCAACACTTTCCAGCTA 0: 1
1: 0
2: 0
3: 16
4: 138
Right 923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG 0: 1
1: 0
2: 0
3: 1
4: 115
923505714_923505720 13 Left 923505714 1:234604838-234604860 CCAGAAAACCCAGATCAACACTT 0: 1
1: 0
2: 2
3: 13
4: 194
Right 923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG 0: 1
1: 0
2: 0
3: 1
4: 115
923505716_923505720 4 Left 923505716 1:234604847-234604869 CCAGATCAACACTTTCCAGCTAC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG 0: 1
1: 0
2: 0
3: 1
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923505720 Original CRISPR CGTCCACAAAGGCCACCCAA AGG Exonic