ID: 923508106

View in Genome Browser
Species Human (GRCh38)
Location 1:234624196-234624218
Sequence TCCACTGAGGTCCCCAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923508106_923508109 -4 Left 923508106 1:234624196-234624218 CCCTTTCTGGGGACCTCAGTGGA No data
Right 923508109 1:234624215-234624237 TGGACTTCTTTTGCATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923508106 Original CRISPR TCCACTGAGGTCCCCAGAAA GGG (reversed) Intergenic
No off target data available for this crispr