ID: 923509720

View in Genome Browser
Species Human (GRCh38)
Location 1:234639844-234639866
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923509712_923509720 16 Left 923509712 1:234639805-234639827 CCTCCAGTACAATGTTCCTAACA No data
Right 923509720 1:234639844-234639866 GTGTATTATGAGTGGGAAGAAGG No data
923509711_923509720 17 Left 923509711 1:234639804-234639826 CCCTCCAGTACAATGTTCCTAAC No data
Right 923509720 1:234639844-234639866 GTGTATTATGAGTGGGAAGAAGG No data
923509713_923509720 13 Left 923509713 1:234639808-234639830 CCAGTACAATGTTCCTAACATAC No data
Right 923509720 1:234639844-234639866 GTGTATTATGAGTGGGAAGAAGG No data
923509717_923509720 0 Left 923509717 1:234639821-234639843 CCTAACATACAAGGGGCATATGT No data
Right 923509720 1:234639844-234639866 GTGTATTATGAGTGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr