ID: 923515398

View in Genome Browser
Species Human (GRCh38)
Location 1:234693952-234693974
Sequence CCAACCAGTCCATACTAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923515398_923515404 11 Left 923515398 1:234693952-234693974 CCAAATTAGTATGGACTGGTTGG No data
Right 923515404 1:234693986-234694008 GCTGGGTTACTCAGTACTCTTGG No data
923515398_923515402 -6 Left 923515398 1:234693952-234693974 CCAAATTAGTATGGACTGGTTGG No data
Right 923515402 1:234693969-234693991 GGTTGGGTGCACATCCTGCTGGG No data
923515398_923515405 30 Left 923515398 1:234693952-234693974 CCAAATTAGTATGGACTGGTTGG No data
Right 923515405 1:234694005-234694027 TTGGTTGTCCTCAGTATTGAAGG No data
923515398_923515401 -7 Left 923515398 1:234693952-234693974 CCAAATTAGTATGGACTGGTTGG No data
Right 923515401 1:234693968-234693990 TGGTTGGGTGCACATCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923515398 Original CRISPR CCAACCAGTCCATACTAATT TGG (reversed) Intergenic