ID: 923515403

View in Genome Browser
Species Human (GRCh38)
Location 1:234693983-234694005
Sequence AGAGTACTGAGTAACCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923515403_923515405 -1 Left 923515403 1:234693983-234694005 CCTGCTGGGTTACTCAGTACTCT No data
Right 923515405 1:234694005-234694027 TTGGTTGTCCTCAGTATTGAAGG No data
923515403_923515406 5 Left 923515403 1:234693983-234694005 CCTGCTGGGTTACTCAGTACTCT No data
Right 923515406 1:234694011-234694033 GTCCTCAGTATTGAAGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923515403 Original CRISPR AGAGTACTGAGTAACCCAGC AGG (reversed) Intergenic