ID: 923515405

View in Genome Browser
Species Human (GRCh38)
Location 1:234694005-234694027
Sequence TTGGTTGTCCTCAGTATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923515403_923515405 -1 Left 923515403 1:234693983-234694005 CCTGCTGGGTTACTCAGTACTCT No data
Right 923515405 1:234694005-234694027 TTGGTTGTCCTCAGTATTGAAGG No data
923515398_923515405 30 Left 923515398 1:234693952-234693974 CCAAATTAGTATGGACTGGTTGG No data
Right 923515405 1:234694005-234694027 TTGGTTGTCCTCAGTATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923515405 Original CRISPR TTGGTTGTCCTCAGTATTGA AGG Intergenic
No off target data available for this crispr