ID: 923518476

View in Genome Browser
Species Human (GRCh38)
Location 1:234717663-234717685
Sequence TGTCCTCTCTTTGCAACACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923518472_923518476 -2 Left 923518472 1:234717642-234717664 CCTGGTCTGAATTCCTCACCCTG No data
Right 923518476 1:234717663-234717685 TGTCCTCTCTTTGCAACACGAGG No data
923518471_923518476 15 Left 923518471 1:234717625-234717647 CCATTTTCAGACATTATCCTGGT No data
Right 923518476 1:234717663-234717685 TGTCCTCTCTTTGCAACACGAGG No data
923518469_923518476 16 Left 923518469 1:234717624-234717646 CCCATTTTCAGACATTATCCTGG No data
Right 923518476 1:234717663-234717685 TGTCCTCTCTTTGCAACACGAGG No data
923518468_923518476 17 Left 923518468 1:234717623-234717645 CCCCATTTTCAGACATTATCCTG No data
Right 923518476 1:234717663-234717685 TGTCCTCTCTTTGCAACACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923518476 Original CRISPR TGTCCTCTCTTTGCAACACG AGG Intergenic
No off target data available for this crispr