ID: 923519185

View in Genome Browser
Species Human (GRCh38)
Location 1:234722818-234722840
Sequence GTCTTCAGCGAGAAGGACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923519185_923519195 9 Left 923519185 1:234722818-234722840 CCCTAGTCCTTCTCGCTGAAGAC No data
Right 923519195 1:234722850-234722872 AGGGTGGCAAGGCAGAGGTCTGG No data
923519185_923519194 4 Left 923519185 1:234722818-234722840 CCCTAGTCCTTCTCGCTGAAGAC No data
Right 923519194 1:234722845-234722867 CAAGGAGGGTGGCAAGGCAGAGG No data
923519185_923519197 13 Left 923519185 1:234722818-234722840 CCCTAGTCCTTCTCGCTGAAGAC No data
Right 923519197 1:234722854-234722876 TGGCAAGGCAGAGGTCTGGAGGG No data
923519185_923519192 -7 Left 923519185 1:234722818-234722840 CCCTAGTCCTTCTCGCTGAAGAC No data
Right 923519192 1:234722834-234722856 TGAAGACGGTACAAGGAGGGTGG No data
923519185_923519196 12 Left 923519185 1:234722818-234722840 CCCTAGTCCTTCTCGCTGAAGAC No data
Right 923519196 1:234722853-234722875 GTGGCAAGGCAGAGGTCTGGAGG No data
923519185_923519191 -10 Left 923519185 1:234722818-234722840 CCCTAGTCCTTCTCGCTGAAGAC No data
Right 923519191 1:234722831-234722853 CGCTGAAGACGGTACAAGGAGGG No data
923519185_923519193 -2 Left 923519185 1:234722818-234722840 CCCTAGTCCTTCTCGCTGAAGAC No data
Right 923519193 1:234722839-234722861 ACGGTACAAGGAGGGTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923519185 Original CRISPR GTCTTCAGCGAGAAGGACTA GGG (reversed) Intergenic
No off target data available for this crispr