ID: 923520891

View in Genome Browser
Species Human (GRCh38)
Location 1:234734341-234734363
Sequence GGGCTTCTTGGCAAAGGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923520888_923520891 -10 Left 923520888 1:234734328-234734350 CCATGTGAAGGGTGGGCTTCTTG No data
Right 923520891 1:234734341-234734363 GGGCTTCTTGGCAAAGGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923520891 Original CRISPR GGGCTTCTTGGCAAAGGTGA CGG Intergenic
No off target data available for this crispr